SimpleSearch - Line and FST details


Line specific information

 
Line ID 157G04
Vector Used pAC161
Line Availability only available from NASC (N415052)
Segregation Analysis 100:90:65
Confirmed for Hit At1g06490
Parent of DUPLO pair none
Parent of pair(s) 5459, 5479, 5483, 5493, 5552, 5555, 10374

Gene hit At1g06490

 
Sequence (A. th genome BLAST matches underlined)
>31-K013213-022-157-G04-8409
TTGATCCATGGTAGATTTCCCGGGACATGAAGCCTTTACAATTGAATATGATGGATCAAT
TAAATTTTAGATCGTTCTCTACCTGCAAAGATATCTTCGCTTAAGTTTATTATCTTTGAA
GCCTTGCTAATGCCTCCTCTTGTGATGTGGAAGATTCTATCAAATATATCAGGATGGCCA
TAATGGAAACGCACCCTGTAAAAGAATCGTGGGTAAGTTGCCAAAGACCAAAGCTATGGG
ATCCTCTATATGGTG
GenBank Accession AL758339 [GenBank]
Graphic View Graphic view of gene At1g06490
Predicted Position of Insertion Chr1:1987050 - go to primer design
BLAST e Value 5e-90
Hit Clone Code (BAC ID) F12K11
Hit Gene Code At1g06490 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation glucan synthase-like 7
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL758339 [GenBank]


Last Updated on 31.08.2016 09:40