SimpleSearch - Line and FST details


Line specific information

 
Line ID 158B07
Vector Used pAC161
Line Availability only available from NASC (N415091)
Segregation Analysis 50:22:21
Confirmed for Hit At1g48310
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g48310

 
Sequence (A. th genome BLAST matches underlined)
>14-K118836-0022-158-B07C-8409
ATTGAAATCCATCTCTTCCACAGTCAAATCCCAGAAATCATCCATTTTGATATTCCCTCT
CCTCCACTTCTTCTTCTTTTTTCGGATGATGTGATGTGAGCTTCTTCAATGGCGGAGGAA
TCTCTCTTCTCAAATCGATCTTTCCCTCTCTCTCCGTCTTCGCCTTTTCAAAGTTTACAT
TCCCAAACGTCACCGTTTCAGAGCGGTTTACTTTCGATGATGACAAGGGCGACAGATGCA
CCAGTTTCAGGGCAAATCCGGTTATTAACTCGGGTCGATTCAAATAATTCGGTTTATGGA
ATCCACTAACCGGTTTTCTGAAGAAACAATTGTGGTTTACATTAAATCCAATGATCGATT
TTATTTTCAAATTGATTTTTCCGTACGATTTCGGCTTTAACCAGCTTGACAATCCTAA
GenBank Accession HG968791 [GenBank]
Graphic View Graphic view of gene At1g48310
Predicted Position of Insertion Chr1:17853693 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F11A17
Hit Gene Code At1g48310 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation chromatin remodeling factor18
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL758380 [GenBank]


Last Updated on 31.08.2016 09:40