SimpleSearch - Line and FST details


Line specific information

 
Line ID 158D11
Vector Used pAC161
Line Availability only available from NASC (N415119)
Segregation Analysis 100:74:61
Confirmed for Hit At4g12020
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F16A14

 
Sequence (A. th genome BLAST matches underlined)
>84-K013215-022-158-D11-8409
TTGATCCATGGTAGATTTCCCGGACCATGAAGCCTTTACAATTGAATATAATTATAGATA
TATGCTGACAAAACTCAAAAGTTAAGATCAGTTTACTATTCAAAATTGAACAGTAAAAGG
TTAAAAAAAATATGTATACTTATGAAAATAACTAAATTCATAGATAATCTTTTAAAATTC
AGAGTTTCTTTTTCTTATATCAAATTCAAAATGAAAACACAAACTAAAATAAACAACGAC
ACATATCATAAGGTCTTTTATATTTTGTATTAGATCAAAACTATTATTGCAATCACATTT
CTTGTGGTAATAAATGAAAGGAATTCTACTCCTAAAGCCAACGTGTGTCCCACACAAAGT
AAGAAGAATGTTTATATTATCTTTTGCTCTTGCAAAGTCAAATGTATCTTCAAAAAGTCA
TGTTGCTATGGGATCCTC
GenBank Accession AL758415 [GenBank]
Graphic View Graphic view of sequence AL758415 of line 158D11
Predicted Position of Insertion Chr1:4774967 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F16A14
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At4g12020

 
Sequence (A. th genome BLAST matches underlined)
>84-K013242-022-158-D11-8409
TTGATCCATGTAGATTNTCCCGGACCATGAAGCCTTTACAATTGAATATATCTCAAAGCT
GTGAAGGACAAGTTTGAAGACAGTGAGAAATATGACACTTTCCTTGAAGTCTTGAATGAC
TGTAAACATCAGGGGTACTCTCTTCTATCTTTCCATTATGTCTCTCTTCTTACAGCAGGA
AATATATTAATTTTTTGTGGTGACTCATGTTGGATGTAGAGTTGACACTATGGGATCCTC
CCTATAGTGAGNNG
GenBank Accession BX546555 [GenBank]
Graphic View Graphic view of gene At4g12020
Predicted Position of Insertion Chr4:7202736 - go to primer design
BLAST e Value 2e-98
Hit Clone Code (BAC ID) F16J13
Hit Gene Code At4g12020 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation protein kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03