SimpleSearch - Line and FST details


Line specific information

 
Line ID 159A05
Vector Used pAC161
Line Availability only available from NASC (N415173)
Segregation Analysis 100:53:38
Confirmed for Hit At1g77130
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g77130

 
Sequence (A. th genome BLAST matches underlined)
>33-K012549-022-159-A05-8409
ATTTGAATGCAAAGCTTCATCTTCCTGTAAATTCTTTATTTGTCTTTCATTCCTTTATCC
CCTCATGATTACATTGTTTCTGGGATTCGTATACAGGTTTCAAGCTGATAATAAAAAAAC
AAAAGAACATATCCAACCCACATTTGGTTGGCGAAAGGCAGAGTAATTTGTACCAAACCA
GAAAGCCAAAAGAATTCACAGGGAAGGGAGAGCGGTTTTATGCGGCGGTGATGAAGTGGT
GGTGGTGGAAGAATTGTTGGTAGAGTTCGTCTCACCCCAATGCCAAAGCATACTCTCCCA
AAAGCAGAAATCTTCGAAACAAGTCTTAAGTCTCTTGTCTTTGATCTTTATCTTCCAATG
TCCATCTTTGTAGTTCCCTTTCTCTGCTTGTCTCCTATCCCATTCAAGTTGCGCCTTCTG
TTTCGATCTTAGTAGACAGAACTTATGCAAGTTTTCAGGCATTGCGTCGTGCACTCTCCA
CCAGGTTTTATGAGCCTCGTCACTATGGGATCCTCCCTATAGTGAG
GenBank Accession AL937903 [GenBank]
Graphic View Graphic view of gene At1g77130
Predicted Position of Insertion Chr1:28978871 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T14N5
Hit Gene Code At1g77130 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation plant glycogenin-like starch initiation protein 2
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences


Last Updated on 31.08.2016 09:40