SimpleSearch - Line and FST details


Line specific information

 
Line ID 161H11
Vector Used pAC161
Line Availability only available from NASC (N415455)
Segregation Analysis 50:15:12
Confirmed for Hit At1g32250
Parent of DUPLO pair none
Parent of pair(s) 6409, 6412, 10633, 83143, 83231, 83240

Gene hit At1g32250

 
Sequence (A. th genome BLAST matches underlined)
>88-K013272-022-161-H11-8409
GTGATCCATGGTAGATTTCCCGGACATGAANGCCTTTACAATTGAATATATCCTGCGAAC
TCCTGGAAGTTAATCCGGCCATCGCCATCGCTATCCGCCTCCTTTATCATCCCCGTCAAT
TCCGCCACCGTCAAGGCGTGGCCAAGCTTATCCATAGAGTGAGCCAATTCCGCCGCAGTG
ATAAACCCGTGTGCCATCCGTGTCGAATATCCTAAACAATCGGAGAAGCTGCTCCTCCGT
GTAAGGAGTTGTCCTCTTCGCCGGCGAAAGAAGCTCCGGAGAGACCAAAGCTACGAACTC
CGGGAACTCTACGAGTCCGTTGCTTTTAGTGTCGGCTTTGTCTATTAGCGTTTCGAATTG
GTCTGGACTTGGTTTAACCCCTATGGGATCCTCCCTATAAGT
GenBank Accession AL758748 [GenBank]
Graphic View Graphic view of gene At1g32250
Predicted Position of Insertion Chr1:11640301 - go to primer design
BLAST e Value 1e-179
Hit Clone Code (BAC ID) F27G20
Hit Gene Code At1g32250 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Calcium-binding EF-hand family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit T19F6

 
Sequence (A. th genome BLAST matches underlined)
>88-K013267-022-161-H11-8409
CTTGATCCATGTAGATCTTCCCGTACATGAAGCACTTTACAATCTGAATATAGTCTCGTG
AGTTATATTCAATATGCAAAGTCTATGATACGCCACTAACTTTAGGGTATGGGCGCGATA
AGGGTTATCCGCGTCACATCAGTGAACAGTCGCTATGTAAAATACTACCATGTGAAAAGG
ACTGGCGTATTTATAGATATATGAGTCTTATTCTGTGTGGCAGCTCAGATGATGGATGAC
GTGACCACTGAGAATTACGTCGATGGAAACATGACGATAAATGCGGTCGCTTGTAGTGTA
CTACATATGGAAACAAAAATAAAAATAGAGGACTATAAGATAACGGAAACAAAGGTGGAA
AGAAGTACAAGATATTATCTATGGGATCCTCCCTATAGTGANNNNNN
GenBank Accession AL758747 [GenBank]
Graphic View Graphic view of sequence AL758747 of line 161H11
Predicted Position of Insertion Chr4:12549711 - go to primer design
BLAST e Value 6e-31
Hit Clone Code (BAC ID) T19F6
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 07.07.2016 14:03