SimpleSearch - Line and FST details


Line specific information

 
Line ID 163E03
Vector Used pAC161
Line Availability only available from NASC (N415603)
Segregation Analysis 100:83:63
Confirmed for Hit At5g60830
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g60830

 
Sequence (A. th genome BLAST matches underlined)
>21-K013269-022-163-E03-8409
GTGATCCATTGTAGATTTCCCGGACATGAANGCCTTTACAAGAGATCTACAATTGAAGAT
CCATATTTTCCGGCAGATGTGCTATTACCCATGAGAAATGCAGAGAGCAACATCATATGA
CCGCAATGTGAATTATCTAAGAGGAGAACCATCAAACCGTCCCACCAACAGTCCCTTTGG
TAAGTAAAAAAAAAAACTTTCTTTTTCCACTTTTTTATGGGATCCTCCCTTTTAGGGNAA
CCNNNNNANNANNNNAATTATNNCCACTGGCTTCNTCCACTGATAACAGGACGAGCAGAG
CGAGGTATGTAGGCGGTGCTACAGAGCGCTCGCAGTGGNGGCCTACCTACGGCTACCCTA
TGGGATCTTGCCTATCGGGAGGGTGGGGGGGCCCCGCCCCTATCCAACGCTTTTCTTTTT
CGCTCCCCCGCGAGTGGGGGCCCCAAGCCAATCAGGCGCCGCACGGCGCGGAGGTCCGCC
GCCCGCCCCGGTCGGCGTGTTGGGTTCAATGGGAGGGCGATATGGCAGGAGCGAGCGCCC
GTAGCCGGTGCGCGAATCACCGCTGTGCGCGGGCCGCGTGGCTCGCGTCAGAGCGCGCCC
ATTTGCGCCGGTAACGCCGTACCGTTTATGTGTATTCCGTGGGCGAATCTCCCGTTCGGG
CGATCGGCGACCGTGCTCCCGTGCACGGAGCGAGAATACGCGTGCCGGGGGTCCTGGCGA
AACCGCGGCGGGCCAGAGTACAATCTCGTGACAGCCGGCGCGCCGGCGCGTGTTGTTCCT
CACCCGCCGCGGTGGTGTTTTCCAGCCCTTTTCTTCGGGTCATTTCCGTGGGTGGGGACG
GTCCGCCGTGTCCGTACCGACCGACCCGGCGGGGCGTCGCGATCCGCGCCGCGGACGGTG
CACCCGGTGGATATCCTAATTGCAGTTCCCATAGTGCGCTCGCGTGTGCCACAACACGCC
TAC
GenBank Accession AL937904 [GenBank]
Graphic View Graphic view of gene At5g60830
Predicted Position of Insertion Chr5:24473054 - go to primer design
BLAST e Value 5e-53
Hit Clone Code (BAC ID) MAE1
Hit Gene Code At5g60830 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation basic leucine-zipper 70
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL937905 [GenBank]


Last Updated on 31.08.2016 09:40