SimpleSearch - Line and FST details


Line specific information

 
Line ID 165C11
Vector Used pAC161
Line Availability only available from NASC (N415779)
Segregation Analysis 50:12:10
Confirmed for Hit At5g65700
Parent of DUPLO pair none
Parent of pair(s) 2227, 3479, 8239

Gene hit At5g65700

 
Sequence (A. th genome BLAST matches underlined)
>72-K118656-0022-165-C11C-8409
CGGACATCTACATTTTTGAATTGAAAAAAAATTGGTAATTACTCTTTCTTTTTCTTTTTC
TCTTTACCGCCGAACATGTGCTCCGGTAACAAGTTAGAAACTTTAATCACTCTTGGAAAC
TTTCTCTTTGGTTCAATCCCTGATTCTCTTGGTAAATGTGAGTCTTTGACCCGGATCCGA
ATGGGTGAGAATTTCCTGAACGGGTCAATCCCAAAAGGACTATTCGGATTACCCAAATTA
ACTCAAGTGGAGCTCCAAGATAATTATCTCTCCGGAGAGTTACCAGTCGCCGGAGGTGTC
TCTGTTAATCTTGGTCAGATCAGTTTATCAAACAACCAGCTCTCAGGTCCATTACCTCCG
GCGATCGGGAACTTCACCGGCGTTCAGAAACTTCTTCTTGATGGAAACAAGTTCCAAGGT
CCTATTCCTTCAGAGGTAGGGAAGCTTCAGCAGCTCTCGAAGATTGATTTCAGCCACAAC
TTGTTCTCCGGTCGAATCGCGCCGGAGATTAGTCGTTGCAAGCTCTTAACGTTTGTTGAT
CTGAGCAGAAACGAGCTCTCCGGTGAAATCCCAAATGAGATCACTGCTATGAAGATATTG
AATTACTTGAACCTGTCGAGAAACCATCTGGTTGGATCAATCCCTGGTTCAATCTCGTCA
ATGCAGAGCTTAACATCTCTTGATTTCTCTTACAACAACCTCTCCGGTTAGTTCCGGGAA
CAGGACATTCAGTAC
GenBank Accession HG968794 [GenBank]
Graphic View Graphic view of gene At5g65700
Predicted Position of Insertion Chr5:26282946 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MPA24
Hit Gene Code At5g65700 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Leucine-rich receptor-like protein kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03