SimpleSearch - Line and FST details


Line specific information

 
Line ID 165F12
Vector Used pAC161
Line Availability only available from NASC (N415816)
Segregation Analysis 50:25:24
Confirmed for Hit At2g40370
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g50370

 
Sequence (A. th genome BLAST matches underlined)
>94-K013365-022-165-F12-8409
GTGATCCATGGTAGATTTCCCGGACATGAAGCACTTTACAATTGAATATATACATGAAAA
AAAATTTGTCATTTTTGTTTTGTTTCATCTTTGTTCTGTAAGCAAGACCAATTTTTATCA
TCTCAGCTTATTTGCAGTTTAGCACGGTTTGATTAGGTTCTGGGTTAATCTCAGGCTTAT
AAAATTCATCAAGCTCAAAAATAGTCCACTACAAGAACATAGAAGACCATTAATCAACAT
TCAACAGTAATTTGTTTCTAATCTAATTATTTGGTTTTGTTCAATAATCCTATGGGATCC
TCCC
GenBank Accession AL759110 [GenBank]
Graphic View Graphic view of gene At1g50370
Predicted Position of Insertion Chr1:18661914 - go to primer design
BLAST e Value 7e-120
Hit Clone Code (BAC ID) F14I3
Hit Gene Code At1g50370 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Calcineurin-like metallo-phosphoesterase superfamily protein
Insertion Classification TS2TE (3')
Confirmation Status unknown

Gene hit At2g40370

 
Sequence (A. th genome BLAST matches underlined)
>94-K013360-022-165-F12-8409
GTGATCCATGTAGAATTTCCCGTACATGAAGCACTTTACAATTGCTGATTCATGTGAATG
CACCCTCTGGGGCCTATAAGAAAAACAGAAAACATCACCGAGTTAACAAATAAAATTGGA
AAGGTGATTACGTCTCTTGAATTCTTGGTTAACACGCTTTTTCTATTGACTTTTGATGTA
ATATTCCATAATTGCCATAAACATAGTACATATAAATTATACACTAATATAAGATTTTGT
TTTGGACCCTCCATTAAATGGATCAATTTAGTATCTGGAGATGTGTACACTGGGTTGCCA
ACAAAATTTGAGTACGCAATGTTGCGCGATCTCTATCTAAATAAATATCAAATGCTCATG
TAATTGACCTGCATGCACGGATACACAACATGTAAATATTCCCCAAGATTGGACACTATA
ATTCTCTAAGATTGGACAGCTTTAATTGACATTTAATACATAAAGGCTTGACATAGGATC
GTTTTGATAATGGCTAATCAATAGTTATGCTA
GenBank Accession AL759109 [GenBank]
Graphic View Graphic view of gene At2g40370
Predicted Position of Insertion Chr2:16860878 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T3G21
Hit Gene Code At2g40370 [TAIR] [MIPS] [SIGnAL]
Gene Annotation laccase 5
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23