SimpleSearch - Line and FST details


Line specific information

 
Line ID 166H07
Vector Used pAC161
Line Availability only available from NASC (N415931)
Segregation Analysis 100:99:95
Confirmed for Hit At5g19330
Parent of DUPLO pair none
Parent of pair(s) 12452

Gene hit F23N19

 
Sequence (A. th genome BLAST matches underlined)
>24-K020160-022-166-H07t-8409
TTTTCGCGCCGTACCATATAACCCTATGCTATGTCTACCATATGCATATCATATTCGCAT
ACGATCGACTTATGAAAAATTAAATTTGCAAAATATTAAGATGTCGAAATTGTTTAAAAG
ATAAGTGTTAGATAATCTATGGGATCCTCCCTATAGTGAGTAAAGAGCAATTGCAGTTTT
GTGTTGCTATGATCCATTTCTTGAATCTAGAAGCTTCATTAAATGTCCTAATCCTCCTCT
ATGGGCAATACTACCTTGATTGTGGGCATCCTGCAAGAAATAGTATGCTATGGGATCCTC
CCTATAGTGAGACNTGCATCNTCGTGGTTACAACAACATCTTG
GenBank Accession BX530799 [GenBank]
Graphic View Graphic view of sequence BX530799 of line 166H07
Predicted Position of Insertion Chr1:23268926 - go to primer design
BLAST e Value 2e-56
Hit Clone Code (BAC ID) F23N19
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At5g19330

 
Sequence (A. th genome BLAST matches underlined)
>56-K013366-022-166-H07-8409
TGATCCATGTAGATTTCCCNGACATGAAGCACTTTACAATTGAATATATCCTGATATACG
GGGATCAGATTGTCATTTACTTTTTCTCCAAACTTCAGTATCCTGATTTCAGTAGAGGAA
GAGTGGCAACGCCATACATACTTGAACAATAAACTCTCCATCCTGTAGCTTTTGGATACC
TCCCACCCTGATAAAATCTGACACATTATCCTATGGGATCCTCCCTAGTAGTGACACAGA
ACAATTGTTCNGTTCTTTCTGTTTTTATAACGACCCTATGGGATCCTCCCTATAGCGAGG
GGCGGGCTGGCCACTCACCCATCCCCATGGTCATTACTTTGGATTTGACTTCCAAATAAT
AACAAAGATCTGCCATAATAAAAATGTTAACCTGCTTTTACAATCCTACAGGCCAGCACA
TCCTTATTAATTGACGTTGGGTTTTAAAGGGTATACACCGATCCTAAATTTTGAAGAAGT
TGATGTTCCAATTTTCCGGGCAAGAATACATATATTGAGCACAAGAAAACTTTCGGAAGC
CAAACC
GenBank Accession AL759242 [GenBank]
Graphic View Graphic view of gene At5g19330
Predicted Position of Insertion Chr5:6509948 - go to primer design
BLAST e Value 7e-52
Hit Clone Code (BAC ID) F7K24
Hit Gene Code At5g19330 [TAIR] [MIPS] [SIGnAL]
Gene Annotation ARM repeat protein interacting with ABF2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CT026148 [GenBank]


Last Updated on 14.10.2014 10:23