SimpleSearch - Line and FST details


Line specific information

 
Line ID 166H07
Vector Used pAC161
Line Availability only available from NASC (N415931)
Segregation Analysis 100:99:95
Confirmed for Hit At5g19330
Parent of DUPLO pair none
Parent of pair(s) 12452

Gene hit At1g62835

 
Sequence (A. th genome BLAST matches underlined)
>56-K013361-022-166-H07-8409
TGATCCATGTAGATTTCGCGTACATGAAGCACTTACAATATGATATAGTGCTGTCAGCTC
ATTTACTGCTTTATTGGCTATGAGATCCTCCCTATAGTGAGAATGGCTGGGNGCGGCCAT
TCACTCATGTATAATTTATACGTGCATACTATATATACATTGATTGTGCCATTCCTATGG
GATCCTCGCTATAGTGAGCATATGCATATCATATTCGCATACGACCAACTTATGAAAAAT
TAGATTTGCAAAATATTTAGTTTTCGAAATGGCGCAAAAGATAAGTGTTAGATAATCTAT
GGGGGGGGGCGTATACCGCCCCCACCANNANNNNTTANGNNCGTNTGTTGGTTGGGTTGT
CCGGGGCGGTGGAAAAAAAAAAAAAAAAAACGTTTGGCCCCGCGGGCCGGGGTCCTCCCG
GCTGGGTCGGTGCCGTCCCTCCGCCGCGCGTTTTTCGCGAGCGGCCCGAAACCCACGCCC
CGCCAATTGGGGCGGGAGGCCAGGTCCAAAAAATAGAGGGGCCGGCGTGCGCCGGAACGT
CGGCCGAGAGAAAATAAACGCCATCCCGCGCACCGCGGGTTCCGGGGGCCCACGCCAACG
GGGGAAGCCGGCCCGCTTTGTTCGATGCGTCCCACGACGCCGGTGGGAGAATTACCCACA
TTTCGGCCGCCCTACATTTTTCGCCCCGCCGCCGGTTGGTACCGATACAACCACGGCCCG
GCATTCCGCGCGATCCACGCCCCGGAATCCGGTTTCGAATAACATTGCGGGCGCCGCCGC
GCACCAGAGTTTAAAACCGGGCCCATTGTCGCGCGCGTTCACTTCCGCCCCCCCCCGGTT
CCACCCACGGGCCGGATGCGCGAAGACACGACGGGCGCGGTGGGGATGTCGGAAAACACC
GAACGGCCGAATCCCCCGCCAGATCACCGGGATAATGTTAATAAATAAAACGA
GenBank Accession AL759241 [GenBank]
Graphic View Graphic view of gene At1g62835
Predicted Position of Insertion Chr1:23268930 - go to primer design
BLAST e Value 2e-33
Hit Clone Code (BAC ID) F23N19
Hit Gene Code At1g62835 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation  
Insertion Classification 5' region
Confirmation Status unknown
Other FSTs Supporting this Hit AL759241 [GenBank]

Gene hit At5g19330

 
Sequence (A. th genome BLAST matches underlined)
>56-K013366-022-166-H07-8409
TGATCCATGTAGATTTCCCNGACATGAAGCACTTTACAATTGAATATATCCTGATATACG
GGGATCAGATTGTCATTTACTTTTTCTCCAAACTTCAGTATCCTGATTTCAGTAGAGGAA
GAGTGGCAACGCCATACATACTTGAACAATAAACTCTCCATCCTGTAGCTTTTGGATACC
TCCCACCCTGATAAAATCTGACACATTATCCTATGGGATCCTCCCTAGTAGTGACACAGA
ACAATTGTTCNGTTCTTTCTGTTTTTATAACGACCCTATGGGATCCTCCCTATAGCGAGG
GGCGGGCTGGCCACTCACCCATCCCCATGGTCATTACTTTGGATTTGACTTCCAAATAAT
AACAAAGATCTGCCATAATAAAAATGTTAACCTGCTTTTACAATCCTACAGGCCAGCACA
TCCTTATTAATTGACGTTGGGTTTTAAAGGGTATACACCGATCCTAAATTTTGAAGAAGT
TGATGTTCCAATTTTCCGGGCAAGAATACATATATTGAGCACAAGAAAACTTTCGGAAGC
CAAACC
GenBank Accession AL759242 [GenBank]
Graphic View Graphic view of gene At5g19330
Predicted Position of Insertion Chr5:6509948 - go to primer design
BLAST e Value 7e-52
Hit Clone Code (BAC ID) F7K24
Hit Gene Code At5g19330 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ARM repeat protein interacting with ABF2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CT026148 [GenBank]


Last Updated on 31.08.2016 09:40