SimpleSearch - Line and FST details


Line specific information

 
Line ID 167D08
Vector Used pAC161
Line Availability only available from NASC (N415980)
Segregation Analysis 50:41:38
Confirmed for Hit At5g15980
Parent of DUPLO pair 2415
Parent of pair(s) none

Gene hit At5g15980

 
Sequence (A. th genome BLAST matches underlined)
>60-K013362-022-167-D08-8409
GTGATCCATGTAGATTTCCCCGGACATGAAGCACTTTACAGTTGAATATATTCGTCGTAC
CAAGATATGATGTTTGGATTGTTGTATGTGCAAGTACCCTTTGAGCAGATTATCCGTTAC
TTGTGAACACCGTAATCTTGTATGCGGTTCTTACTTGATTGTGGACGTCTAAGCAACAGC
CAACTTCTCTGATGACTTATCTCATATGAGAGCTCCGAGTTCACAACCATTGAATAGATA
ACACACTGATACTTCATCAAGATTCCCTGTATCACAATGCCCTTCAACAAGAGACGCCAT
TGCCTTGTCGTCGTATGGGATCCTCCCTACACCGACATACTTCTGATGTACTGTGGCACC
CTAATTCGTCTGTGTGGAAACCAAAATAGAAAAACTCGTTG
GenBank Accession AL759302 [GenBank]
Graphic View Graphic view of gene At5g15980
Predicted Position of Insertion Chr5:5214938 - go to primer design
BLAST e Value 3e-17
Hit Clone Code (BAC ID) F1N13
Hit Gene Code At5g15980 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Pentatricopeptide repeat (PPR) superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At3g13810

 
Sequence (A. th genome BLAST matches underlined)
>60-K013367-022-167-D08-8409
GTGATCCATGGTAGATTCCCCGGACATGAAGCACTTTACAGTTGAATATATATCGCGTAC
AATGATTAGGCCGGGATTGTCGTATGTGCAGTACCCTTTGAGCCGAATACCCGTAACGAG
TGATCCGCTTTTCTTTTCTTCTTGTGTGCCTTGATCATGAACGTCTTATCGACGGCCAAG
TTCTCCGAGGACGTTGCAGAACATGGAGGCTCCCACGTTCGACACCTTGTAATATATACT
GGCGGGTATGTCAGCGGGATTGCCTCTGGGCAATGACCTTTACACCGAGACGCCCTTGCC
TTGTCCTGTATGGGCTCCCTCCGGAACCAACATACATCTGTTCTTCGATGCCACACCTAG
TCTCATCTGTATGGGATCCTTAATTAATAGACTCGCGGGAACAAGCAGAACCCGTCTGTG
ATTATCTGCAATATAAGTTTTCAAAGAGACCACAATCTCCTCCTGTTTAAAAGAGGTCAC
AATCTGCCATAGTAGCTGAAACA
GenBank Accession FR804878 [GenBank]
Graphic View Graphic view of gene At3g13810
Predicted Position of Insertion Chr3:4545221 - go to primer design
BLAST e Value 2e-06
Hit Clone Code (BAC ID) MCP4
Hit Gene Code At3g13810 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation indeterminate(ID)-domain 11
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 07.07.2016 14:03