SimpleSearch - Line and FST details


Line specific information

 
Line ID 168A03
Vector Used pAC161
Line Availability only available from NASC (N416035)
Segregation Analysis 100:88:69
Confirmed for Hit At5g58850
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g58850

 
Sequence (A. th genome BLAST matches underlined)
>17-K013363-022-168-A03-8409
ATGATCAAATAACATCACATGATCATGGATGTAGCTATGGGATCCTCCCTATA
GenBank Accession AL759350 [GenBank]
Graphic View Graphic view of gene At5g58850
Predicted Position of Insertion Chr5:23765489 - go to primer design
BLAST e Value 7e-12
Hit Clone Code (BAC ID) K19M22
Hit Gene Code At5g58850 [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 119
Insertion Classification 3' region
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23