SimpleSearch - Line and FST details
Line specific information
Line ID | 168A03 |
Vector Used | pAC161 |
Line Availability | available as T3 set from NASC (N416035) |
Segregation Analysis | 100:88:69 |
Confirmed for Hit | At5g58850 |
Parent of DUPLO pair | none |
Parent of pair(s) | none |
Gene hit At5g58850
Sequence (A. th genome BLAST matches underlined) | >17-K013363-022-168-A03-8409 ATGATCAAATAACATCACATGATCATGGATGTAGCTATGGGATCCTCCCTATA |
GenBank Accession | AL759350 [GenBank] |
Graphic View | ![]() |
Predicted Position of Insertion | Chr5:23765489 - go to primer design |
BLAST e Value | 7e-12 |
Hit Clone Code (BAC ID) | K19M22 |
Hit Gene Code | At5g58850 [Araport] [TAIR] [MIPS] [SIGnAL] |
Gene Annotation | myb domain protein 119 |
Insertion Classification | TS2TE (3') |
Confirmation Status | confirmed, show confirmation sequences |
Primer and wt-amplicons | show primer details |
Last Updated on 10.06.2021 13:37 |