SimpleSearch - Line and FST details


Line specific information

 
Line ID 168B12
Vector Used pAC161
Line Availability only available from NASC (N416056)
Segregation Analysis 50:50:40
Confirmed for Hit At4g39330
Parent of DUPLO pair none
Parent of pair(s) 8473, 8499, 10066, 10072, 10076, 59717, 92909, 92910

Gene hit At4g39330

 
Sequence (A. th genome BLAST matches underlined)
>90-K013363-022-168-B12-8409
GTGATCCATGTAGATTTCCCCGACATGAAGCACTTTACAATTGAAGCTCTACTGGGTATT
CTAGACTTGTGCTCTGATGTAGTATACTAATCGACAATTTTTTTTACGAATCACAAAATA
CATTGCTATGGGATCCTCCCTATAGTGAGCGAATCATCACTCAGATGATTGATGGCTTTC
TCTGCTTTCGTATAATAAGAACTTGTGCCAGTTACTATCACACCAATAGCTTTACCAATC
TTAACAGGGGCATGACGCATCCCTCCTATTCTAGCAACCCCTAAATGCTTCCCTGCCTCA
GTCATACCATGGTGACTTATTGGACTCTACACAGTGATTCCAGCACACAGCAACGGCGCA
CCCGAATCGCTCGGTAAATTCTCAAAAAACCGCAAAACAAACCGTTGATCAACCACAATG
TTCTCCGAATAGCCACCGTAATTCTTGGTTCCATCGGATCCAATCGCATTGTATGTGAAA
GACATTTGAGGACAGTAGTTTTCAAGATCCTGGTCACAACATTCGCAAGATTGGCACGAG
CCACTGATCACTCCTACTGCGACACGATCTCCTTCTTTGGAATTAGTCACGTTCTTACCA
CCTCTTGGAGCGATCCCACCGATTTCATGCCTAACTAATATCCAAGGGTTTTGTATATAA
TAGAAAACCTGTTAAA
GenBank Accession AL770134 [GenBank]
Graphic View Graphic view of gene At4g39330
Predicted Position of Insertion Chr4:18292291 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T22F8
Hit Gene Code At4g39330 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation cinnamyl alcohol dehydrogenase 9
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40