SimpleSearch - Line and FST details


Line specific information

 
Line ID 169C03
Vector Used pAC161
Line Availability only available from NASC (N416155)
Segregation Analysis 50:41:37
Confirmed for Hit At1g11250
Parent of DUPLO pair none
Parent of pair(s) 5014, 5069, 5083, 7482, 7503, 8599, 11321

Gene hit At1g11250

 
Sequence (A. th genome BLAST matches underlined)
>19-K013387-022-169-C03-8409
TTTGATCCATGTAGATCTTCCCTTACATGAACGCCTTTACAACTTGAATATATCCTGGAA
GTTTACTTCTCCATTTTAAATTACCAATAGATCACTTTAGCCATTTTCATATATATCATT
TTTACTCTGTCTTTATTTTCTTTCTCTGGCTTAATTATGTACAGAAGTTTTTTTTTGGGG
GTTTTATGTGTTTTTTTCTTTGATTTCGTTTTCGTCCAAAAGCAATGGATTATGAGGAGG
AACATCGCCATCGACCTCCTTTGTATTATTAAAAGGAACAAAATCCTATGGGATCCTCCC
TATAGGGAGGCGTATCACTCACCCGCACCCTTATAGAAAGCGAATGCTAATACCCGTAAT
GTCCCTGGGTGTGGGCCAGGTTCATCAACGGATAGGACTCGATCTTCTGAGGTTAGCGGT
CTCGGGAACAACCTCAAAGACTCGATGGATAGCCTTCAAGGTCTACGCGCTCGTATGAAC
AATGATCATAGGGAAACCGTACACCGCAGG
GenBank Accession AL770233 [GenBank]
Graphic View Graphic view of gene At1g11250
Predicted Position of Insertion Chr1:3768737 - go to primer design
BLAST e Value 2e-55
Hit Clone Code (BAC ID) T28P6
Hit Gene Code At1g11250 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation syntaxin of plants 125
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03