SimpleSearch - Line and FST details


Line specific information

 
Line ID 170C06
Vector Used pAC161
Line Availability only available from NASC (N416254)
Segregation Analysis 50:45:35
Confirmed for Hit At1g47760
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g47760

 
Sequence (A. th genome BLAST matches underlined)
>43-K013465-022-170-C06-8409
CTGATCCATGGTAGATTTCCCGTACATGCGACGTTTTCNAGACGCCGAAATGGCATTTTT
AAGAAGGCTGATGAACTCGCGAAGTTGTGTAATGTAGAGATTGCTGTCTTGGTCATCTCC
CCCACTAATATACCATACACATACGGTTATCCATGCTTCAACGATGTGGTTGAGCGTATT
CAAAATCCTATGGGATCCTCCCTATAGTGAGNNNNNNNNN
GenBank Accession AL770311 [GenBank]
Graphic View Graphic view of gene At1g47760
Predicted Position of Insertion Chr1:17572505 - go to primer design
BLAST e Value 3e-85
Hit Clone Code (BAC ID) T2E6
Hit Gene Code At1g47760 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation AGAMOUS-like 102
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03