SimpleSearch - Line and FST details


Line specific information

 
Line ID 170E12
Vector Used pAC161
Line Availability only available from NASC (N416284)
Segregation Analysis 50:39:37
Confirmed for Hit At3g15690
Parent of DUPLO pair 2464
Parent of pair(s) none

Gene hit At1g78922

 
Sequence (A. th genome BLAST matches underlined)
>93-K013467-022-170-E12-8409
NTGATCCATGTAGATCTTCCTGACATGAAGCACTTTACATTTTAGTACACCCATCTTTGA
CTTTGAGAGTCTTTATTTTCCTCGATTTAATCTTTCTATGGCATCCTCACTATAGTGAGA
GGAAGCCAACGACCGGCACTGACTACTTTATACATGTGAACGGTACAAAGAAGGATGTAG
TTGATACCAGCGGACAGAACAGGTGGAGTCCGTATAGGCCTACTACCATAAGAGACTCCG
AGGGGAGGTGACCTGGCGAATCTGTGCAACGGTTGCAACCGATGCTACGATGGCCATGGA
TGAAATCCAAGCGGGAGAAATGACTATCCTAGCACTGGAAAGCAGCAACGGGACCCTCCC
TATAGNGAGCAGCCGCGCACGGAAGACGACGCGGCGCACGGACATGACCTATGGCTGGGA
AGTCGCATCCGACCATCGGGCGAGAGATACCAATCCACGGAAGCCTCCAT
GenBank Accession AL770345 [GenBank]
Graphic View Graphic view of gene At1g78922
Predicted Position of Insertion Chr1:29676960 - go to primer design
BLAST e Value 7e-18
Hit Clone Code (BAC ID) F9K20
Hit Gene Code At1g78922 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation unknown protein
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At3g15690

 
Sequence (A. th genome BLAST matches underlined)
>93-K013465-022-170-E12-8409
TGATCCATGTAGATTTCCCGGACATGAAGCACTTTACATTTTAATACACCCATCTTTGAC
TTTGAGAGTCTTTATTTTCCTCGATTTAATGTTTCTAGTACTTCTTCTTACTCTTCTTGA
TTAGCCTACAACTCGTACAGACACTTGTCTACTCGGTATTCTGTATGAGACGGCGGATGT
TGCGATTGCTGCCATGATGGTGGTGGCTGTGTTTGCTTCCTATGGGATCCTACATATAGA
GATACTTCATTTGATATTGAATTGCCAAGCTAATCTAATTGATGAGTTTGGCAGTGATAA
GTTAATTTCATAATTTGTATCTCTTAATATGAATTACTCGACAACATTACTTAATCTTTC
ACTGTTGAGTATACGTGGAGATCGGTTAACGTGAGTTTATTCTAAGACATTATATTTTGA
ATTACTTAAAACTTTCTGGAGCTATCTTGGATTGAGTGTATAAGATTTGCTTATGCTCAA
TTTTAAAAAGTGAGGGATCATATTGAAGATAAGTGCTTATTTAGTCTTTCTTTTTGACTC
TGTCTTGTTTTGGCTGATTTCCCATATTGAGACCTTGGCGTATGACGTATGTTACAGGTA
GCCTATGGGATCCT
GenBank Accession AL770344 [GenBank]
Graphic View Graphic view of gene At3g15690
Predicted Position of Insertion Chr3:5317227 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MSJ11
Hit Gene Code At3g15690 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Single hybrid motif superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03