SimpleSearch - Line and FST details


Line specific information

 
Line ID 171B05
Vector Used pAC161
Line Availability only available from NASC (N416337)
Segregation Analysis 50:45:42
Confirmed for Hit At1g55530
Parent of DUPLO pair 11771
Parent of pair(s) none

Gene hit At1g55530

 
Sequence (A. th genome BLAST matches underlined)
>34-K013466-022-171-B05-8409
NTGATCCATGGTAGATTTCCCGGACATAGAAGCCTTTACAATTGAATATATCCTCAAAAC
GAGGTACAGACCGAGAACAATGAAGACGATGGAGAAAATGATTTGGATTGGCAGCTTCAA
GAGATTCTCAGGAGAAGGAGAAGACATTCCGCTGCTGTTTTGCAGTTGCTTCAGGGGATA
CGAGCAGGGTTGTCTGTAGAATCTGAGAGTACTGGTAATGGAGGTAATAATCCGGGACGG
GTGATCTTGATCAATACCTCCAATCAAACTATCACGGTTCAAAACTCTGCTGATATGGAT
TCTGTACCTGCTGGTTCTTTAGGTGACTATTTCATTGGTCCTGGATTTGAAATGTTGCTT
CAACGCCTATGGGATCCTCCCTATAGTGAG
GenBank Accession AL770403 [GenBank]
Graphic View Graphic view of gene At1g55530
Predicted Position of Insertion Chr1:20730270 - go to primer design
BLAST e Value 1e-173
Hit Clone Code (BAC ID) T5A14
Hit Gene Code At1g55530 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation RING/U-box superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL770404 [GenBank]


Last Updated on 31.08.2016 09:40