SimpleSearch - Line and FST details


Line specific information

 
Line ID 171G05
Vector Used pAC161
Line Availability only available from NASC (N416397)
Segregation Analysis 100:98:98
Confirmed for Hit At2g40740
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g40740

 
Sequence (A. th genome BLAST matches underlined)
>39-K013466-022-171-G05-8409
TTTGATCCTGTAGATTTCCCTGACTGAAGCCTTTACATTGAATAGTTTATGGGATGCCTA
CTATATTAGCTTACTGTTAGATTTGGGCATTTTACGTATAACTTTCTTAACCCTATGGGA
TCCTCCCTATAGTGAGGTGTTGGNGGCGGCGCTAAGGACGGGGAACACAGATCTGCCACC
CGACGATAACCATACTTGGCGTAGATACGGTCACAAAGAAATTCTTGGCCATATGGGATC
CTCCCTATC
GenBank Accession BX546567 [GenBank]
Graphic View Graphic view of gene At2g40740
Predicted Position of Insertion Chr2:16998324 - go to primer design
BLAST e Value 3e-39
Hit Clone Code (BAC ID) T7D17
Hit Gene Code At2g40740 [TAIR] [MIPS] [SIGnAL]
Gene Annotation WRKY DNA-binding protein 55
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23