SimpleSearch - Line and FST details


Line specific information

 
Line ID 172F06
Vector Used pAC161
Line Availability only available from NASC (N416482)
Segregation Analysis 50:38:38
Confirmed for Hit At3g45640
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g14070

 
Sequence (A. th genome BLAST matches underlined)
>46-K013458-022-172-F06-8409
CTGATCCATGGTAGATTTCCCGGACATGAANGCCTTTACAATTGAATATGATATATAACA
GGAACACGAGGCCAACGTACAAGAATTGTTCTATCTGGCTACGGCCTATGGGATCCTCCC
TATATGTGAAGAAATGGATAAATAGGCTCGCTACCTATTATATCTTCCCAAATCACCAAT
ACATTACACTATGGGATGCTCCCTATAGAGAGACTGTTTACCCCACAAAAAAAGCAAAGA
ATAAAGATGTCAAGTTTACTTGTATAAGTGGAAAGAGAGAAAGTCCCATCTCCAAAAAAA
ACCCTACGTTAAAACCCANCCACCAAAACCTGGAAATAAAAAAACCATTTTACTCGTGAA
ACGCTTTATTCCTAACTTAACTATGGGACCCCCCCTATCCGGAGGCTACATACGTGTCAT
GTCTTCTCACGATTCTGCACATCCGCGTAATTATCGCATGGCGGCCCACAAACTGACGCC
CAGTTGACATACTGTCTA
GenBank Accession AL770564 [GenBank]
Graphic View Graphic view of gene At2g14070
Predicted Position of Insertion Chr2:5922316 - go to primer design
BLAST e Value 3e-14
Hit Clone Code (BAC ID) F9B22
Hit Gene Code At2g14070 [TAIR] [MIPS] [SIGnAL]
Gene Annotation wound-responsive protein-related
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At3g45640

 
Sequence (A. th genome BLAST matches underlined)
>46-K013469-022-172-F06-8409
NTGATCCATGTAGATTNTCCCGGACATGAANGCCTTTACAATTGAATATATTGTCGGGTA
AACCTAAGGACAAAAGAGCGTTATATTAGAATAGTCGGATATTTAAAAGGGCGTCGATAA
GGTTTATCCGTTCGTCCATTTGTATGTGCATGCCACCACAAGGTTCCCCTAGGGAGAGCT
TGGCATTCTGTGCGATAATGACTTCTGTGCAACCACCCAAACGTCAGAAAGCCTGACGAC
GGACCAGCATACCAAAAAGATCCCTTGGCTCGTCTGGGTCGGCTATGGGATCCTCCATTA
AGTGGAGGAGAAATGAACACCGGCGGTGGCCAATACACGGATTTTCCGGCGGTGGAAACT
CACGGAGGACAGTTCATAAGTGACGATATCTTCTGTTAGTTTATTCGAGATCACATCTAA
GTATCGTCCTCCGATTATACCAATTGGTCGTGGAGCTTATGGAATCGTTTGGTATGTTTC
CTTCTCTGAGCTTTTTCTTAAGTATTATTCTTTGAAATCGGAGTTTTTAATTTCTGGATT
TTGATT
GenBank Accession AL770565 [GenBank]
Graphic View Graphic view of gene At3g45640
Predicted Position of Insertion Chr3:16756913 - go to primer design
BLAST e Value 4e-118
Hit Clone Code (BAC ID) F9K21
Hit Gene Code At3g45640 [TAIR] [MIPS] [SIGnAL]
Gene Annotation mitogen-activated protein kinase 3
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23