SimpleSearch - Line and FST details


Line specific information

 
Line ID 173D01
Vector Used pAC161
Line Availability only available from NASC (N416549)
Segregation Analysis 100:100:76
Confirmed for Hit At2g46270
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g46270

 
Sequence (A. th genome BLAST matches underlined)
>04-K013459-022-173-D01-8409
TTTGATCCATTGTAGATTTCCCGGACATGAAGCACTTTACATTCTAGTATGATTATCCAT
ACATCTTGGTTGTAGATTTGCGGAATGGAATGACCTGGTTCCCGCTTAACGTACTGAGTA
CTGATCCGGGAATACTTCTCGAAAAGAGTGTGGGTGAGCTGACGACAACGGGTTGGATTG
GTGATTACATTCCGTGACACCCTCCTTTTCATGGGATAATTGTTTAAACCATCCTATGGG
ATCCTCCATATTTTGACATTCGCTGACGCCAGAGACCGAGGGTCTGATCATGCCTATGGG
ATCCTGCCTATAGAGATTACGCTCATCCCGGTATTCCCATGGTATATAGTAATTCTGTTC
CTCAAACATCTCGTACTTGAATCCTCCGTGATCGTTTATCTGACTTGGCTTTGAGTTTCT
GTGGACAGGGATCACTGCCTCAAGGTCAAAAGGATCCACCTTTAACAACTGCACGTTGTA
TACCTATGGGATCCT
GenBank Accession AL937909 [GenBank]
Graphic View Graphic view of gene At2g46270
Predicted Position of Insertion Chr2:19001129 - go to primer design
BLAST e Value 4e-84
Hit Clone Code (BAC ID) T3F17
Hit Gene Code At2g46270 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation G-box binding factor 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03