SimpleSearch - Line and FST details


Line specific information

 
Line ID 173G02
Vector Used pAC161
Line Availability only available from NASC (N416586)
Segregation Analysis 50:43:43
Confirmed for Hit At1g03220
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g03220

 
Sequence (A. th genome BLAST matches underlined)
>15-K013459-022-173-G02-8409
TTGATCCATGTAGATTNTCCCGGACATGAAGTCCTTTACAATTGAATATATCCTGCGGGA
CATATTATCGCATAAAATTATTAAATAAAATTGTAATGATTTATCAAATAAAATTCACTC
GTTACATAATTTATTCAAATCAGTTGATAACAAATGCCAAATAATGATTCCATTGGCTCT
TTATTAATCACATCAAACATAATATAATAACCACTAAAAAACAGTTTTAAAAAAAGAAAA
CGGATCAACTAATTTAATCAAGCAGTGGAAGTGAAATTGAAGTTGGCGCAGTTAGTTTGA
CGGCCCAATAACGTGGAACTAAACCCAAATTTGTTACTCGCCAAATCAAATTCGATCAAA
TTATCCTCCAACTGAAACCCTCCAATCACAACAGAGGTTCTTGCGTTGACTCCTCCGTCA
ACGAAACCCAAACAGATGACGTCATCACTGACACTCACCATCGAGTTGGCTCCAAATATC
CTCCAAACGACGTCTTTGCTATGAAGCACAAGCTCAATCTCCGGCACGGCGTATCCTATG
GGATCCTC
GenBank Accession AL770668 [GenBank]
Graphic View Graphic view of gene At1g03220
Predicted Position of Insertion Chr1:788643 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F15K9
Hit Gene Code At1g03220 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Eukaryotic aspartyl protease family protein
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit T6B13

 
Sequence (A. th genome BLAST matches underlined)
>15-K013470-022-173-G02-8409
TTGATCCATGTAGATTCTCCCTTACATGAAGCACTTTACAATTGAATATTACCTGTGATG
CAAAAGGGGTTCTGTCCATAAATATGACATTTCTTTAGCTAATAATTACTTGAATCGGTA
ACTAATATAACCTAATAAAGACCTTGTTTGTTTTTTAATCTTGTGGAAGCATATTCTTTA
GCAAAATATGACATTTCATTAACTATAAAAATAACTGAATGGGGATGGGGGCGTATCTCA
TTTATTTATATAGCCAGATTTATAGACCTACTAATATGGCTGCTATGGGATCCTCCCTTA
AGTGAGANNNCNNNNNCCNNNNNCCCCCCCNNCCCCCCGCCCCCTCCCCCGCCCCCCCCC
CCCGGCCCCCCNCCAACCCCCGCCCCCCCGCCGCGCCCCCCCGCCCGCCGGGGCCCCGGG
CCGCCGGCCGCCCCCGNCGCGGCCGCCCCGCCCCGCCCGCAACAAACAATAAAAACCAAC
CCGCGCCCGCCGTACGTCGCCTNCCCACCCCCCCCCTTCCCATCACCTCATTATTTCAAT
ACCAACATATCGTTACCAAACCAAGAACCCCGCCCCTACCCCTTCGGCGTCCGCATCCCC
CCCGACACAATCATCCGACGTCCCGCATTTCCCTCCCCGCCTCCTCCTCCTTTCCG
GenBank Accession AL770669 [GenBank]
Graphic View Graphic view of sequence AL770669 of line 173G02
Predicted Position of Insertion Chr2:6239236 - go to primer design
BLAST e Value 1e-118
Hit Clone Code (BAC ID) T6B13
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 14.10.2014 10:23