SimpleSearch - Line and FST details


Line specific information

 
Line ID 174B09
Vector Used pAC161
Line Availability only available from NASC (N416629)
Segregation Analysis 50:36:35
Confirmed for Hit At2g41370
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g41370

 
Sequence (A. th genome BLAST matches underlined)
>66-K013531-022-174-B09-8409
CTGATCCCATGTAGATTTCCCGNACATGAAGCCATTACCACAAGAGATCTCCCTCTGTGC
GATCCTACACATATACAGATTTTATAGCACTAGCGCGTATGCGCTCCTTACCTATAGTGA
TTAACTTTGCCATCGATTAATATCTTATCTTTATACCCTAATTTCTTCCTATGGGATCCT
CCCTATAGTGANNNNNNNNNNNNNNNNNNNNNNNNNNN
GenBank Accession AL770722 [GenBank]
Graphic View Graphic view of gene At2g41370
Predicted Position of Insertion Chr2:17237839 - go to primer design
BLAST e Value 5e-22
Hit Clone Code (BAC ID) F13H10
Hit Gene Code At2g41370 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ankyrin repeat family protein / BTB/POZ domain-containing protein
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit K7L4

 
Sequence (A. th genome BLAST matches underlined)
>66-K013516-022-174-B09-8409
TTGATCCATGTAGATTTCCCGGACATGAAGCACTTTACAATTGAATATATCCTTAATCTA
TCTAGTGTTTTGTATATATAACTACTCGTGCACATATCCCTATACCACCTAAAAATCAAA
AGAGTGCTTTGGGATCATCCCTATAGTGATGATATAGGGGATCCTTCTTACAATGAGGTG
AACGTGAAATATTANATTTGTTTGACAACAAACTTATTATTGATTAATTAGAAGCATTTG
AAAACAATATGGGGCAATAAATCTAATCATGTTAGTGAGTTAGACAAATTTTTTCACAAC
CATCTCAAATTATGTCAAAGTAATGGGTCAATGGTTATGCTTTGTCAGCATTTATGATCC
CATAACTTAAGTAAATTATCTATTGAATGCAAGAAATAAGGTTTATCTATGGGATCCTCC
CTATAGTGAGNNNNCNCNNNNNNNGGGGGGGCGGCCGCGGCGGTCCGCGGCGGCCCGCGC
GGCGGCCGCGTTTCCGCACCGAGCCGCCCCCCCCCGAAAGATAAAAATAACGACGAAACA
AAAACAAGTGATGTAAACGCGCGGTAGGACCGCGCGGAGCTAGACGAGGGGCTGTGGGGT
AGCGAGGTCTTTCGGGTTTTTTTCCATAGTCGGTGCAGGCGCGGCGTGATTTTTTTCGTC
GTATATTGCGCCGCCAGCTCCGGATAGCGCGATACGAAAGCGCGGGAAAAAGCGCCCGTC
GGATAATTTACGCGGTGTTGTTATTTTTCGGCCGCGCCCGAATAACTGGGCGCGCGGGAA
GTCGCGTGGCGTAAATATGTTAATCAAAGTGAGTCGCCCACGCGCCCTTTTACGCCCGAC
CTTTGCGCCAAGAACGGGAGATATTACGATATAACCCGCCCGCACGGCCCGCTGGAAGCT
TTGCGGGCGGCGCGACGCACGCCGCCCCGTAATATTCGCGAATGAATAATGAGATTATCT
GenBank Accession AL770721 [GenBank]
Graphic View Graphic view of sequence AL770721 of line 174B09
Predicted Position of Insertion Chr3:5163781 - go to primer design
BLAST e Value 4e-115
Hit Clone Code (BAC ID) K7L4
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 14.10.2014 10:23