SimpleSearch - Line and FST details


Line specific information

 
Line ID 174G03
Vector Used pAC161
Line Availability only available from NASC (N416683)
Segregation Analysis 100:99:96
Confirmed for Hit At2g43000
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g43000

 
Sequence (A. th genome BLAST matches underlined)
>23-K013531-022-174-G03-8409
CTGATCCATTGTAGATTTCCCGCACATGAAGCCTTTATAGTAAGTTTAGGTGCTCAAGAC
TTAGTCTATGTGTCTACTAAAACTAGCCTATGGGATCCTCCGTATAGTGATTTTTGTNAT
ACTATATGATTATTTAATTTTTATAAAGAAAATTCACGAAAAATACATAACTTCCATTGA
TTGCCATTGACTCAATGAAAAGAAAAAGTCTCAATTTAACTATAAGAGAATCCGATTCGA
ACAACAATAGCCACTATGGGATCCTCCCTATAGTGAG
GenBank Accession BX649762 [GenBank]
Graphic View Graphic view of gene At2g43000
Predicted Position of Insertion Chr2:17881005 - go to primer design
BLAST e Value 9e-73
Hit Clone Code (BAC ID) F23E6
Hit Gene Code At2g43000 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NAC domain containing protein 42
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03