SimpleSearch - Line and FST details


Line specific information

 
Line ID 175D06
Vector Used pAC161
Line Availability only available from NASC (N416746)
Segregation Analysis 50:49:39
Confirmed for Hit At1g74920
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g74920

 
Sequence (A. th genome BLAST matches underlined)
>44-K013517-022-175-D06-8409
CTGATCCATGGTAGATTTCCCGCACATGAANGCCTTTAGCAATTGAAGTTGTCCTGGACA
TGAAGCACATGCTGGGTGTACAAAGTCTTTGTGCTTTGATTATCAGTGCTGTGTATGGGA
TCCTTCCGTTAGCGAGCAAGTAGTTATCAAGTCCCCTGAAGCACGCAAGAAACCAGCCAT
AACCAAGATTTGTTCAGTACAAGCCATCAAGATATAGTCTTTTAAAAACAAGATTCGAGA
TAGAAAAAGAAATGTACCATTCTCCAAGTTCTCGTCCAAACCCACTGCGTTTGACACCAC
CCCATGGGGCTTGGGTAAAGCAAGGCTGCGAGCAGTTAATCCAGACAATCCCAGCTTCAA
AGGCCTAACAAAGTAGACACCAATTGTTTGTGTTATTTGATGGTATTGTTATTTCACTTG
CTATGGGATC
GenBank Accession AL770861 [GenBank]
Graphic View Graphic view of gene At1g74920
Predicted Position of Insertion Chr1:28139163 - go to primer design
BLAST e Value 4e-161
Hit Clone Code (BAC ID) F25A4
Hit Gene Code At1g74920 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation aldehyde dehydrogenase 10A8
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03