SimpleSearch - Line and FST details


Line specific information

 
Line ID 175F11
Vector Used pAC161
Line Availability only available from NASC (N416775)
Segregation Analysis 100:100:87
Confirmed for Hit At3g52970 At3g27700
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g52970

 
Sequence (A. th genome BLAST matches underlined)
>86-K013517-022-175-F11-8409
NTGATCCATGGTAGATTTCCCGGACATGAANGCCTTTACACTTGAATACCTGCAGACTAG
TGCGACTCTAGCTAACATGCAGTAAACGAGTGAGCTATAGCAGAAGTGCATACTGAAAAA
CGGTCGGGCTATAACTTAATCCATGCTTCAAAAACCTAATGGCTTATCTATGCGCAGCCT
CCCTGCAGTGACGACATTCCACAAAGGTGGATAAAGATCGTATAAGCCAGGAACACCAGC
GCTATAGGATCCTACATATAATGAGAGAACGAACGGAGGTTAGGGAGAGAGAAAAGAGCG
ACGAGAAGACGAAAGATTACTTAGATGTTCTTTTGGAGTTTCGTGGTGGCGATGGAGTCG
ACGAAGAACCTTCTATGGGATCCTCCCTATAGTGAGNNNNNNNNNNNNNNNNNNNNNNNG
NCGNCCNCNNNNNNNNNNNCNNNNNNNNNNCCNCCNCGNCGCGCCCCCNNNCGNNNNCNC
CGCGCCCGCCCCCGGNCCCCGGCCGGCGCCCCCCCGCCCCCCGCCCCNNGCCNGNGCCCC
GCCGCCGCGCCCCCCCCCCGCCCCCCCCCCGCGCCCGCCGCCCCCCCCCGGCGCGNCGCC
GCGCCGCCGCNCCCCCCCCCCCCCCCGCCCCCCCCCGCNGCCCCGGCCGNCGGCTCGCGC
GCGCCCCCGCCCCCCCCCCGCGGTCGCCTNCGCGGGCCCCGCGCCGGCCCCCCCCGNTCC
CCCCGCCGTCCCGCCTCCCGCCCCCCCCTTCCCCCCCCCCCCGTTTGTTCGACCCGTTAC
CC
GenBank Accession BX649763 [GenBank]
Graphic View Graphic view of gene At3g52970
Predicted Position of Insertion Chr3:19642456 - go to primer design
BLAST e Value 1e-56
Hit Clone Code (BAC ID) F8J2
Hit Gene Code At3g52970 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation cytochrome P450, family 76, subfamily G, polypeptide 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At3g27700

 
Sequence (A. th genome BLAST matches underlined)
>86-K013532-022-175-F11-8409
CTGATCCATGTAGATTTCCCGGACATGAANGCCTTTACACTTGAATCTATGCAGCCTATG
CGATCCTACCTATATGTGACTACACCCATTTTCAGCGGCGTCTTGGTTACTGTCATCCAG
TGGAGCCACATTTTCATCAACCCCATGAAAATTGAGTGTATATATTGCACCTGAAGTTTC
ACCAGTACTATTATTCCACAAAGGTTGATCAGGATCGTAAAAGTCAGTTCCACCAGCACT
ATGGGATCCTCCCTATAGTGAGAGAACGAACGGAGGGTAGGGAGAGAGAACCGAGCGACG
AGAAGACGAAAGATTACTTACATGTTCTTTTGGAGTTTCGTGGTGGCGATGGAGTCTACG
AAGAACCTCCTATGGGATCCTCCCTATAGCGACTCCCTTTTGTTTTT
GenBank Accession AL770901 [GenBank]
Graphic View Graphic view of gene At3g27700
Predicted Position of Insertion Chr3:10259843 - go to primer design
BLAST e Value 4e-78
Hit Clone Code (BAC ID) MGF10
Hit Gene Code At3g27700 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation zinc finger (CCCH-type) family protein / RNA recognition motif (RRM)-containing protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40