SimpleSearch - Line and FST details


Line specific information

 
Line ID 175G10
Vector Used pAC161
Line Availability only available from NASC (N416786)
Segregation Analysis 100:73:66
Confirmed for Hit At2g20230
Parent of DUPLO pair 2359
Parent of pair(s) none

Gene hit At2g20230

 
Sequence (A. th genome BLAST matches underlined)
>79-K013532-022-175-G10-8409
NTGATCCATGTAGATCTTCCCGGACATGAAGCACTTTACAATTGAATATATCCTACCTAC
TGCGCTAATGATACTCAGCTAAACAAGAACATCTCTTTTATTATCTGATGGACTAAGCTG
GTTCCATCCACAGATCTGAATAGACACCCTGGTAAAATGACACATGTTTCCGTATGCTAT
GAAGCTGGAGCTCCAGTTTTTAATCTTGCTTGAGCCACCAGGCGCTTGGTTTCCTTGCGG
ACCAAGAAGTGGGTCCCAAGTTCTACTCCTTGGGTTCTCATCATCTTCCTCTTCGTCAAG
TTCGGGTTTCGGGGTTGAAACCATCGCTCTGAGAACCATGGCTATGGGATATGACATATA
CTGAAAGACACAAGAAATATTCATGTCTTCTCTTTAAACTCACTATGGGATCCTCCCTAT
AGTGAGANCTAAGAGACGCCACCCGTAAACCTCCGTTTCATTTGGCCACTGCCTTTCCCA
TTTTCCTCTGGTTTTTTAGAGGCATATTTATCCCCCCCCCCCCCACTCTTATATTTTAAT
TGATTTTTTCCATCTCTCCGTCCCTTATGCCCTTTCCCCCGCCCCCCTTTCCCCCTTTAT
CCCGTCATTCCCATTTCCTCCTTTTCTACCATTTATT
GenBank Accession BX942882 [GenBank]
Graphic View Graphic view of gene At2g20230
Predicted Position of Insertion Chr2:8727352 - go to primer design
BLAST e Value 7e-92
Hit Clone Code (BAC ID) F11A3
Hit Gene Code At2g20230 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Tetraspanin family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX942881 [GenBank]


Last Updated on 14.10.2014 10:23