SimpleSearch - Line and FST details


Line specific information

 
Line ID 176H03
Vector Used pAC161
Line Availability only available from NASC (N416887)
Segregation Analysis 100:48:32
Confirmed for Hit At3g55120
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g55120

Sequence (A. th genome BLAST matches underlined)
>53-K117893-0022-176-H03C-35St
CCTTCGCAGACCCTTCCTCTATATAGGAAGTTCATTTCATTTGGAGAGGACAGGGTACCC
GGGGATCAGTGTCGTTTCCTGAAACCGGGATCGCTGTGATCGAGAACAAATTGTTGGCGG
AGGCGGTTCTGGAATCTATCATCGGGAAGAACGGTGTGTCACCTGGCACTAGGTTAAGTG
TTGCAGAAAGATTATCTCAGCTAATGATGAAGAACAAGGACGAAAAGGAAGTTAGTGATC
ACTCTGTTGAGGAAAAACTAGCCAAAGAGAACTGAGAATGATAGATTTTTCTTGTGTTTT
TGTCATTTTCTATTTCTTATGTTTTCTATATCTAATTTCTTATGCGGTACTCAAGTGGAG
AATAAAGAACATGCATTTACATTATAATAAAGTTTAGGAATTTCGGTGTTTTTCTTTGAA
ATGCTATTCTAACTTGATTTGATGATATATATGTCAAAGATGATTCAACCGTTGAGGTTT
AGATGGGAGTTACTCGGAATCAGATTCCAAAAAACTCTGATAAACCTTATTCGCCAAAAA
CGTTATTAAAGGATGGTGCTTGACATAAGGAAATTATGGTCCAATAAATTGGAATACTCG
GTTGTATTAAAGCAGAGAATCTAACGCTTTTTTGTGGGTTGCGTTTAGCATTGGTTTTGG
ACTTTTCGGTTACATTTTTGGGGAGTCTAATTCTGTTGAAGAAGAGAGAATAGAGA
GenBank Accession HG968800 [GenBank]
Graphic View Graphic view of gene At3g55120
Predicted Position of Insertion Chr3:20430445 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T15C9
Hit Gene Code At3g55120 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Chalcone-flavanone isomerase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Related paper(s) [Rosso et al. 2003, chi-GK01] [Stracke et al. 2010, tt5-2]


Last Updated on 07.07.2016 14:03