SimpleSearch - Line and FST details


Line specific information

 
Line ID 177D02
Vector Used pAC161
Line Availability only available from NASC (N416934)
Segregation Analysis 50:20:17
Confirmed for Hit At4g34870
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At2g01640 can not be ordered because the confirmation of this insertion failed.

Gene hit At4g34870

 
Sequence (A. th genome BLAST matches underlined)
>12-K013534-022-177-D02-8409
NNNTTTTGATCCTGTAGATTTCCCGGAATGAAGCCTTGTTGACATGGTTTTTCTCCAAAA
CCCTAATTTGTCATATCACTTTACAATCTTACTTATCGATTTCTCTCTTCCAATCTCCCA
AAAGATGTCGAACCCTATGGGATCCTCCTTATGAGTGAGGGTAGAGCTGTGATGATATGG
AAATTAACCGTGGTTGAATCGGATCTGACTATGGGATCCTCCCTATAGTGAG
GenBank Accession AL771106 [GenBank]
Graphic View Graphic view of gene At4g34870
Predicted Position of Insertion Chr4:16614392 - go to primer design
BLAST e Value 3e-20
Hit Clone Code (BAC ID) F11I11
Hit Gene Code At4g34870 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation rotamase cyclophilin 5
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At2g01640

 
Sequence (A. th genome BLAST matches underlined)
>12-K013519-022-177-D02-8409
AGAAGGATCTATGGGATCCTCCGTTTTGAGAGATCAAATTACACAAGTTTTGATCTGTAA
CAAACTCGTTTACAGCTTTCCTTTAAGAACACAGTCTCGCCTGTGAGATCTCTCTATGCA
GATTTATGTGATACAGGTCTCATGCTTGAGATTGATGAGTAGTAATCTATGGGATCCT
GenBank Accession AL771105 [GenBank]
Graphic View Graphic view of gene At2g01640
Predicted Position of Insertion Chr2:283911 - go to primer design
BLAST e Value 6e-71
Hit Clone Code (BAC ID) T8O11
Hit Gene Code At2g01640 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation unknown protein
Insertion Classification CDSi
Confirmation Status failed


Last Updated on 07.07.2016 14:03