SimpleSearch - Line and FST details


Line specific information

 
Line ID 178A08
Vector Used pAC161
Line Availability only available from NASC (N417000)
Segregation Analysis 50:48:46
Confirmed for Hit MHC9 At2g27930
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit MHC9

 
Sequence (A. th genome BLAST matches underlined)
>57-K013564-022-178-A08-8409
NTTTTGATCCATGTAGCATTTCCTCGAGCATGAAGCCTTTACAATTGAATACTACCCTGG
ACACACTTCCAGCTGCTGTATTATGATTTAAATGGTCGTTGACTTTTGACCCTTGTGGTT
TTTTGGACAAAACCCTGTGTTTTTATTTCCTTTCTATAAAAAAGATTTATCTGCCTTTGT
TATGCTTTCTTCTTATTAATTAAGTTATCATCGGACAAAGTTCAATTACTAGGGGAGA
GenBank Accession AL771175 [GenBank]
Graphic View Graphic view of sequence AL771175 of line 178A08
Predicted Position of Insertion Chr3:7516716 - go to primer design
BLAST e Value 9e-76
Hit Clone Code (BAC ID) MHC9
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At2g27930

 
Sequence (A. th genome BLAST matches underlined)
>57-K013562-022-178-A08-8409
CTGATCCATGTAGATTNTCCCGCACATGAANGCCTTTACAATTGAATACTCCCTGTACCG
ACTTCCGCTATGGGATCCTCCTATAGTGAGAATTTGTCCGATATAAAATGAGGAATCGGT
TTAAGGATACACCGTATAATGTTTAGTTACTTGTATGGTAAATTCATTGAATCAACTATA
TTCAAACTCGCTTAATACATGTTGTTTGCCTCATATAATGTATCTTAAGAAAATATATAC
GAGGTTAGATGTTTGTATATATGTATATGGTACATTTTGCTCAAAAAAAAAGTATATGGT
ACATTTGCATAACGGAAATGTATGATGTGATCATAATAAAAATGTCAGGTTGAAGGAATG
AGGAAGAATAAGGAAGAGGAAAAAAAAAGATTGCGTAAAGAAAGACAACAAGAAACGCAC
AAAGGCACGCATCCTCCAACTCATACCTCTAATTCTATGGGATCCTC
GenBank Accession AL771174 [GenBank]
Graphic View Graphic view of gene At2g27930
Predicted Position of Insertion Chr2:11893046 - go to primer design
BLAST e Value 5e-176
Hit Clone Code (BAC ID) T1E2
Hit Gene Code At2g27930 [TAIR] [MIPS] [SIGnAL]
Gene Annotation PLATZ transcription factor family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23