SimpleSearch - Line and FST details


Line specific information

 
Line ID 179E12
Vector Used pAC161
Line Availability only available from NASC (N417148)
Segregation Analysis 100:98:92
Confirmed for Hit At3g28910 At4g27980
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g28910

 
Sequence (A. th genome BLAST matches underlined)
>93-K013563-022-179-E12-8409
CTGATCCATGTAGAATTTCCCGGACATGAANGCCTTTACANTTGAATATATGCTGCTTAC
AATGACCGACCTAAATCTGCTCCAATCTCTTTCTTCTCTACAACACTTAACCTACAAGAT
ATTAGACTGCTTAGACAAACACAAACACATTCTCCTTATTTGAACCACTCTGACTCGTTC
TTCCTTCTTCTCCACCGAGGCGGACCAACGTCGTCATACTGAACCGAAGACTCACATATT
GATGAAAATAATCGCCTGAATCTTGACTATGAGATCCTCCATAACCTGAGCCGTTCCTCG
CTCTCATCTTCACCATCGTCTTCTTCTGCTAATTCCAACTCAAACATCTCAAGAGGCCAA
TGGGAAAGGCGACTTCAAACCGATATCCACTTGGCGAAAAAGGCTCTCTCTGAGGCTTTA
TCTCCTGCCGTTGCACCAATCATTACATCTACAGTGACAACAACGTCTTCCTCTGCTGAA
TCAAGACGCTCTACTTCCTCAGCTATGGGATC
GenBank Accession BX890859 [GenBank]
Graphic View Graphic view of gene At3g28910
Predicted Position of Insertion Chr3:10912036 - go to primer design
BLAST e Value 4e-118
Hit Clone Code (BAC ID) MLD15
Hit Gene Code At3g28910 [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 30
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At4g27980

 
Sequence (A. th genome BLAST matches underlined)
>93-K013565-022-179-E12-8409
CTGATCCATGTAGAATTTCCCGGACATGAANGCCTTTACAATTGAATATATCCTGCTTAA
ATGACCAATCTCAAATCAGATTCAATCTCTTTCTCCTCTAAAACACTTAACCTTCGAGAT
ATTGACTCTTCAAGCAAACCAATCTCCTTCTCCTTATTTCAACCACTCTCAGTCGTTCTT
CCTTCTTCTCCAGCGAGGCGACCACGTCATCAAACTGAAGCGAAGACTCAAAAATTGAGG
AGAATATTGCCTGAATCTTGCCTATGGGATCCTCCTTAAAGTGAACCGGGCCTAGATCGA
ATCTTATCCGACGCATACATCTGATACTGACAGACTGAACGACGAAAGAGGCGCATGAGA
AAGGCAACTACGGACCTAGATGCACTTGGCGAAAAAAGCACTGTCTGAGGGTATATATCC
GAGGCGACGCACCGATCTTTACATGATACGAAGACACCGACGAACTGACAGAGGAGACTG
AACAGGCTATACTTGGTCACGATAGGAACGACAATAATTGGAAAAAAAGATTGAAAGAGC
TTGAATTGAAGCAGATGGAATTAGAAGAAACATCANGACCACAACTTGTAGAAGCAGAGT
CTCGGAAGAGATCCAACCTTGAAATTGAACCTCCTTTGTTGGTAAAGAATGATAGTGACG
CTGATTCTTGTACTCCTCAAGCCAAGAAACAGAGGTCTCAGGAAGCATATGATGGAGACA
TTGAAGGAATTGCCTGCCCAGATAAAAGTATGAGGATCCCAACTCATTAACT
GenBank Accession AL771365 [GenBank]
Graphic View Graphic view of gene At4g27980
Predicted Position of Insertion Chr4:13921913 - go to primer design
BLAST e Value 2e-117
Hit Clone Code (BAC ID) T13J8
Hit Gene Code At4g27980 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Domain of unknown function (DUF3444)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23