SimpleSearch - Line and FST details


Line specific information

 
Line ID 179E12
Vector Used pAC161
Line Availability only available from NASC (N417148)
Segregation Analysis 100:98:92
Confirmed for Hit At3g28910 At4g27980
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g28910

 
Sequence (A. th genome BLAST matches underlined)
>93-K013563-022-179-E12-8409
CTGATCCATGTAGAATTTCCCGGACATGAANGCCTTTACANTTGAATATATGCTGCTTAC
AATGACCGACCTAAATCTGCTCCAATCTCTTTCTTCTCTACAACACTTAACCTACAAGAT
ATTAGACTGCTTAGACAAACACAAACACATTCTCCTTATTTGAACCACTCTGACTCGTTC
TTCCTTCTTCTCCACCGAGGCGGACCAACGTCGTCATACTGAACCGAAGACTCACATATT
GATGAAAATAATCGCCTGAATCTTGACTATGAGATCCTCCATAACCTGAGCCGTTCCTCG
CTCTCATCTTCACCATCGTCTTCTTCTGCTAATTCCAACTCAAACATCTCAAGAGGCCAA
TGGGAAAGGCGACTTCAAACCGATATCCACTTGGCGAAAAAGGCTCTCTCTGAGGCTTTA
TCTCCTGCCGTTGCACCAATCATTACATCTACAGTGACAACAACGTCTTCCTCTGCTGAA
TCAAGACGCTCTACTTCCTCAGCTATGGGATC
GenBank Accession BX890859 [GenBank]
Graphic View Graphic view of gene At3g28910
Predicted Position of Insertion Chr3:10912036 - go to primer design
BLAST e Value 4e-118
Hit Clone Code (BAC ID) MLD15
Hit Gene Code At3g28910 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 30
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At4g27980

 
Sequence (A. th genome BLAST matches underlined)
>93-K104550-0022-179-E12-8409
GNAGCCATTTACAATTGAATATATCCTGGCTTCATGACCAATCTCAAATCAGTTTCAATC
TCGTTTCTCCTCTAAAACACTTAACCTTCGAGATATTGACTCTTCAAGCAAACCAATCTC
CTTCTCCTTCATTTCAACCACTCTCAGTCGTTCTTCCTTCTTCTCCAGCGAGGCGACCAC
GTCATCAAACTGAAGCGAAAACTCAAAAATTGATGAAGATTTTGCCTGAATCTTGTCTAT
GGGATCCTCCCTATAGTGAGAGGGNTCCNNNCTCTCNTCTTCNCCNTCTTCTTCTTCTGC
TNNTTCCNNCTCNNCCCTCTCNNAATGCCNNTGGGGATGTGCGACTTCNNACCGNTNTCC
NCTTGGCGAANATGGCTCTCTCGGAGGCTTTATCTCCTGCCGTTGCACCAATCATTACAT
CTACAGTGACAACTTCGTCTTACACTGCGGAATCAAGACGCTCTACTTCCTCNGCTATGG
GATCCTCCCTATAGTGAG
GenBank Accession FR805198 [GenBank]
Graphic View Graphic view of gene At4g27980
Predicted Position of Insertion Chr4:13921957 - go to primer design
BLAST e Value 4e-108
Hit Clone Code (BAC ID) T13J8
Hit Gene Code At4g27980 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation trichohyalin-like protein (DUF3444)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR805198 [GenBank]


Last Updated on 31.08.2016 09:40