SimpleSearch - Line and FST details


Line specific information

 
Line ID 179F04
Vector Used pAC161
Line Availability only available from NASC (N417152)
Segregation Analysis 100:70:63
Confirmed for Hit At4g25220
Parent of DUPLO pair none
Parent of pair(s) 689, 8326, 8362, 9942

Gene hit At4g25220

 
Sequence (A. th genome BLAST matches underlined)
>30-K013563-022-179-F04-8409
TTGATCCATGGTAGATTTCCCGGACATGAANGCCTTAAACGAGGACATCAATGGGAGGTC
TGGATGCTGGTGGTGATGATGATGATGCAGCTACTTCATCTTCTGATCCAACAATAACGC
TTTGACTTCTGCTATGATTAGTTTAGTGAGCAACAATCCAGAGATCAATGCTGCAGTCAT
CAACATGTAAAACACTGCGTCCCAGCTTATGGCAGAGATGTAACCAGTGAGGACTGGTCC
AATCGCAGCACCGACGGATCCTGTGCCGTCTATGATAGCTGAGACTGTAGCCAAAGCCCT
TGCATTGCCTTTGAGAGATTTGTGGGTTCCGAGATCAGCTGAGACAGCTGTTGTGATGAG
AGCAAATGGTCCAATGATGAAGACTCCTGATGTGAACATGAGGATGACATTGATGGTCAA
TGAGATGTGTCCAAAGACTCTGTAGAGGAAAAGAGCTGGGATGGCCAAGTACATGAATCC
TGCTGCTGTGATGGCTCTGCCGTTGAGTTGATCAGATATGTATCCGGCTAAGACTCCACC
AACAACGCCTTCAACATCGAAGAAAGTCGACAAGTTTCCTGATGTCTCCTCTGACAGGTA
CTCTGCTTCGATCACTGCATCACATATAATTCAGACATTGCATATTTAGTCAGGCTACA
GenBank Accession AL771371 [GenBank]
Graphic View Graphic view of gene At4g25220
Predicted Position of Insertion Chr4:12922760 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F24A6
Hit Gene Code At4g25220 [TAIR] [MIPS] [SIGnAL]
Gene Annotation root hair specific 15
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit T6K12

 
Sequence (A. th genome BLAST matches underlined)
>30-K013565-022-179-F04-8409
CTGATCCATGGTAGATTTCCCGGACATTGAAGCCTTTACAATCGATGAATTGACCACAGT
ATCCCTCTTGTATATACATATAAATGGTCAATGTCTTATAATGTAAGATCTTTCTCACAT
ATAAATGGTTAATGCACAATTCTTACAACTTACAAGTTTAGGAACGTTAAAAAAAAAATG
GTCCATGTTTTGTCCCCTTTGTTACCAATTACCAGTGTTTTCGAATTTGTTTTAATCCGG
CTGGCTTGGGGTTACCAAGGAATTTGGGTTCCGGTTGGGTTTTGGTAAAATAAAAACATT
GGTTTTATTTCTGTAGTTGAGGTTCGGTTTGGTTTAATTTGGTTTAACTCTTTATCACTG
TTCTTTACCAGGGACCGATTAAAGCACAAAACAGAGTTTGGGGATGGGAAAAAATGGATT
TTTTTGTACGTTCTCCAATTTTGTTTTTATGGAATGTGCTGAATGTAAACCCTATTATTC
ATCATGTTGGGGAGGGCGAATCGGCGTGATCTTCAGCTTTCTTGCTTGCGGGGTCAAAGG
CAGATTCTAGTTCTTTAAACTGCGATTATGATCTTTGCCCAAAATTGGGGAGCCGCGGTT
CCTTTGATTGCCGCGCCTCCCGCGG
GenBank Accession AL771372 [GenBank]
Graphic View Graphic view of sequence AL771372 of line 179F04
Predicted Position of Insertion Chr3:1142977 - go to primer design
BLAST e Value 5e-179
Hit Clone Code (BAC ID) T6K12
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 14.10.2014 10:23