SimpleSearch - Line and FST details


Line specific information

 
Line ID 179H01
Vector Used pAC161
Line Availability only available from NASC (N417173)
Segregation Analysis 100:97:66
Confirmed for Hit At2g19190
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At4g26630 can not be ordered because the confirmation of this insertion failed.

Gene hit At4g26630

 
Sequence (A. th genome BLAST matches underlined)
>08-K104550-0022-179-H01-8409
AATCTGAAGAATANAACTANGAAGAGGAAGAACCTGAGGAGGATAAGGCATACCAGAAAG
AAGAGACACACTAGGAGGATACTGATAATGGCATTCCTGATAAATCTGAGGATGAGGCCC
CTCAGCCTTCTGAAAGCGAGGAGAAAGATGAATCTGAGGATCATTCTGAAGAAGAAACTA
CTAAGAAGAAACGTGGTTCTTTGGGATCCTCCCTATAGTGAGAAGTTTCACTCTGGTTTA
TTGTTAACCACTCTCTTAAAAAAGCCACCTTTATATCCTCTTCTTTTTTTTTCTCCTCAC
ATTTAGCTTTCTTCTTCCCTCCTTCCTTTTTTTTTCCCTTCTCTTTTTTTTTTTATTTCT
CCCTCGCCCTTTTTTTCCACCTCTTTTTTTTTTTTTTTCCCCTTCCTTTTTTATTCTCTA
TTTTTCCCTTTTTTTTTTTTTATTTTTTTCTTAGTACACTTATTTTTTCACCTCCTTTTT
TTTCCCCCCCCCCCCTCTTTTGCTTCTTTTAACCTCTTACCCTCCTATTTTTATTTTATT
T
GenBank Accession FR805234 [GenBank]
Graphic View Graphic view of gene At4g26630
Predicted Position of Insertion Chr4:13432195 - go to primer design
BLAST e Value 1e-55
Hit Clone Code (BAC ID) T15N24
Hit Gene Code At4g26630 [TAIR] [MIPS] [SIGnAL]
Gene Annotation DEK domain-containing chromatin associated protein
Insertion Classification CDSi
Confirmation Status failed, line belongs to a contamination group, please check line 179G02

Gene hit At2g19190

 
Sequence (A. th genome BLAST matches underlined)
>08-K013565-022-179-H01-8409
TTGATCCATGTAGAATTTCCCGCACATGAAGCACTTTACAATTGAATAGTATCCTTACTT
ACTTACTCTCCCATGAATATCAACCACTCACTATGGGATACTCACCTATAGTGAGATTTC
AAGATGGGACTTCCCGAACCTTGCGCTGCATCTAATGATATCTTCAACCTCTCTTCCCAG
CTCAAGATAAATGACCTTTTACCTTCACAAAATGAAACAAAACCAAAGTTCCTTTCTCAG
TACATTATGAACATAAGATTAGTGAACAAAAGAAGAATCATTAATTAACCTGCCAAATAG
TCTCCTAAGTTCTCATTAGCCATATACTCATAGATAAGCACCATGTGGTTTATTTCGTTG
CAATATCCAACAAGAGAAGTCAGGTTCGTGTGATGAACTCTCATGAGAAGGTCAACCTGC
GATTCTCACCTATGGGATCCTC
GenBank Accession BX546575 [GenBank]
Graphic View Graphic view of gene At2g19190
Predicted Position of Insertion Chr2:8326765 - go to primer design
BLAST e Value 1e-176
Hit Clone Code (BAC ID) T20K24
Hit Gene Code At2g19190 [TAIR] [MIPS] [SIGnAL]
Gene Annotation FLG22-induced receptor-like kinase 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23