SimpleSearch - Line and FST details


Line specific information

 
Line ID 180A11
Vector Used pAC161
Line Availability only available from NASC (N417195)
Segregation Analysis 100:100:95
Confirmed for Hit At3g07390 At5g06780
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g07390

 
Sequence (A. th genome BLAST matches underlined)
>81-K013602-022-180-A11-8409
GCCCTTCTATATAGAACATCACACTGTCCCTGTGTCTTAAAATAACCTCTTATCACACAC
CAAACCACACCAGCAACGGAACTCATGCCCTGGCTTCTTCTTCTTCTTCTCTGTGTAATC
CTATGGGACTCCTCCCTATAGTGAGATAGCCGCTTCGGTCGCCAAGCCCATTCCCCAATA
TTCGCGCCATATGTGATAGCCGATTTCGGGCTCAAGGCCGGCCGGGGTCTCTTGCAGAGT
GATCCCGCAATCACCGATGACCTCCCCCGAAACCGTCTCCACGACTGCCCAGAGACCAAA
TCCATGCTGTGCGTAGCTGTCAAACGCAAGCTTCTGAAACCATTCATTGATTTCTGATGG
AGACTTGGTAGCCGGATAGAACCGCATGCACTCTCGATCAGCGTAAATTCTGCCCAGTGA
AACGAGGTCATCACCTTCGACTTCGCGCAGATGCAATCGTTCAGTCTTCATGACGATTGA
CATAGTCACCTCACGAATTGCGGCTTCGCGGCCTATGGGATCCTCCCTA
GenBank Accession FR805249 [GenBank]
Graphic View Graphic view of gene At3g07390
Predicted Position of Insertion Chr3:2365431 - go to primer design
BLAST e Value 1e-16
Hit Clone Code (BAC ID) F21O3
Hit Gene Code At3g07390 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation auxin-induced in root cultures-like protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g06780

 
Sequence (A. th genome BLAST matches underlined)
>81-K013611-022-180-A11-8409
GTGATCCATGGTAGATTTCCCGGACATGAAGCACTTTACATTTGCTATGCATCTTTAGTA
ATGGAAGCACATTACATGGAGATTAGTTTTCTATATGAACAAAATCATTTTCTCGGATCC
CTTAAAGCAAAACAGAAGAAAAAGAAATATTGCTATGGGATCCTCCCTATAGTGAG
GenBank Accession AL771426 [GenBank]
Graphic View Graphic view of gene At5g06780
Predicted Position of Insertion Chr5:2094015 - go to primer design
BLAST e Value 1e-25
Hit Clone Code (BAC ID) MPH15
Hit Gene Code At5g06780 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Emsy N Terminus (ENT)/ plant Tudor-like domains-containing protein
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40