SimpleSearch - Line and FST details


Line specific information

 
Line ID 180D12
Vector Used pAC161
Line Availability only available from NASC (N417232)
Segregation Analysis 100:96:91
Confirmed for Hit At2g37340
Parent of DUPLO pair 2284
Parent of pair(s) none

Gene hit At1g19110

 
Sequence (A. th genome BLAST matches underlined)
>92-K013611-022-180-D12-8409
TTGATCCATGGTAGATTTCCCGNGACATGAAGCCTTTACAATTGAGCGGGTAAACCTAAG
AGAAAAGAGCGTTTATTAGAATAATCGGATATTTAAAAGGGCGTGAAAAGGTTTATCCGT
TCGTCCATTTGTATGTGCAATGCCAACCACAGGGTTCCCCTCGGGAGTGCTTGGCATTCC
GTGCGATAACTGACTTCTGTTCAACCACCCAAACGTCGGAAAGCCTGACGACGGAGACAT
CATTCCAAAAAGATCCCTTGGATCGTCTGGGTCGGCTATGGGATCCTCCCATTAATGAGA
CCCTTTAACGTTGTTCAACGGTAAAATGTCATGGATGTTTGTGCGCTCTCACGTGGCTAT
GGGATCCTCCCTATAGNGAGNNNNNNNNNNNNNNNNNNNN
GenBank Accession AL771458 [GenBank]
Graphic View Graphic view of gene At1g19110
Predicted Position of Insertion Chr1:6601871 - go to primer design
BLAST e Value 1e-22
Hit Clone Code (BAC ID) F14D16
Hit Gene Code At1g19110 [TAIR] [MIPS] [SIGnAL]
Gene Annotation inter-alpha-trypsin inhibitor heavy chain-related
Insertion Classification Promoter
Confirmation Status unknown

Gene hit At2g37340

 
Sequence (A. th genome BLAST matches underlined)
>92-K013602-022-180-D12-8409
TGATCCATGTAGATTTCCCGGACATGAAGCACTTTCAGGACACCAAGCCGGAGTCTTAGC
CGTAGCCGAAGCTCAGGTTACTACTTTGCCCGTATAAACTTCAAAATTCTGGTTCATGTT
TACGTGTTTACGTGCATTATATTTACTGTATGAACCTGAAAGCATGAATCCGAGTAACTG
CTATCTCTGATTGACTTCTTATTTTCCTTATGGTCAACCGATCACGATCCCCGGTGATAA
GAAGAGAGAGGAGTGTGGAGGAGAGATCACGCAGTCCAAAGCGGATGGATGACTCTCTAT
CGCCAAGAGCCAGAGATCGTAGTCCGGTTCTTGATGATGAAGGCAGCCCAAAGATCATAG
ACGGGAGCCCACCACCATCACCAAAGCTTCAAAAGGAAGTCGGATCTGACCGTGACGGTG
GTAGCCCCCAAGACAATGGCAGAAACTCTGTTGTCAGTCCTGTTGTAGGAGCCGGTGGTG
ACAGTTCGAAAGAGGACCGGAGCCCTGTTGATGATGATTACGAGCCAAACCGCACTTCCC
CTATGGGATCCTCCCT
GenBank Accession BX890860 [GenBank]
Graphic View Graphic view of gene At2g37340
Predicted Position of Insertion Chr2:15670891 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F3G5
Hit Gene Code At2g37340 [TAIR] [MIPS] [SIGnAL]
Gene Annotation arginine/serine-rich zinc knuckle-containing protein 33
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23