SimpleSearch - Line and FST details


Line specific information

 
Line ID 181C04
Vector Used pAC161
Line Availability only available from NASC (N417308)
Segregation Analysis 81:57:51
Confirmed for Hit At5g46540
Parent of DUPLO pair none
Parent of pair(s) 6350, 6352, 84123, 84124, 84125, 84126, 84127, 84128, 84129, 84130, 84131, 84132, 84133, 84135, 84136, 84137
Note Although the line exists, the insertion in MWI23 can not be ordered because the confirmation of this insertion failed.

Gene hit At5g46540

 
Sequence (A. th genome BLAST matches underlined)
>80-K020161-022-181-C04t-8409
TAGATCCGGGTTTTGGAGCAAAAGCAAGAGTTAGTAGTTAGTATTCAACAACNCTTGGTT
AAACTCTGGGTTCTATATAGTCTAACATGATTTCTTACTTCGATTTAGGGAAAATATGAA
GAGCCTATGGGATCCTCCCTATAGTGAGANNNTNCNCTTGCT
GenBank Accession BX530809 [GenBank]
Graphic View Graphic view of gene At5g46540
Predicted Position of Insertion Chr5:18878640 - go to primer design
BLAST e Value 8e-51
Hit Clone Code (BAC ID) K11I1
Hit Gene Code At5g46540 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation P-glycoprotein 7
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX530808 [GenBank]

Gene hit MWI23

 
Sequence (A. th genome BLAST matches underlined)
>27-K013612-022-181-C04-8409
CTGATCCATTGTAGATTTCCCGGACTGAANGCCTGTACATCCGGGTTTTTGGAGCACAAG
TCGGAGTTCCTATTACGTATTCACACCCTTGGTTAAACTCTGGCTCTATATAGTCTAACA
TCATTTCTTACTTAGATTATAGGGAAAATATGAAGAGGCTACTGGGATCCTCCCTATAAG
TGAGAATCGGTCTGCGAAATACAGTATACTCCTAAATTTCATTCTCTCTATGGGATCCTC
CCTTACGTGAGCAGAGAAAGTACGTGGGCAAAATCGTATTAAAACATCCTCCCCATAGCG
TGCTCTCTTTTCCTTAGACGAGTGTCCCACCTTTGACGAACTCAGTGAACGCCAACGCGA
CCAAACCGAGCATCGCGAAACGTCCGTTCCAAAGCTCAGCGTCTGACGTCATGATACCTT
TGGACTTGGACTCAACGCTTATGCCCTTGAAAAGCGGCACATGCGACACAAGTGTCAAGA
TCGCTGTTGTACCGAGGAACCATGAGACGCC
GenBank Accession CT026158 [GenBank]
Graphic View Graphic view of sequence CT026158 of line 181C04
Predicted Position of Insertion Chr3:8084373 - go to primer design
BLAST e Value 5e-133
Hit Clone Code (BAC ID) MWI23
Insertion Classification Genome Hit
Confirmation Status failed


Last Updated on 07.07.2016 14:03