SimpleSearch - Line and FST details


Line specific information

 
Line ID 181D04
Vector Used pAC161
Line Availability only available from NASC (N417320)
Segregation Analysis 100:96:78
Confirmed for Hit At1g73230
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F5I6

 
Sequence (A. th genome BLAST matches underlined)
>28-K013603-022-181-D04-8409
AGAGATGATTACATAAGTGGAAAGTATACCAATACTACTTCTGCAACAACGTTCTCATAC
TGACATATTATTTATTTATTAATCAACTTAACAGTTCGGTTTTAAGATTATCACTATCTA
ACCCTGATTAAACAAAAGCAAGTAGTACAAACAAAAATAGCCAATAATAATTGTAGTAGT
TTCACATAGTGCGCTTTATTAATACTTAGTGGACTTTAGTAACTTATGAACATACTCACT
ATGGGATCCTCCCTATAGTGAG
GenBank Accession AL771566 [GenBank]
Graphic View Graphic view of sequence AL771566 of line 181D04
Predicted Position of Insertion Chr1:30269798 - go to primer design
BLAST e Value 1e-62
Hit Clone Code (BAC ID) F5I6
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At1g73230

 
Sequence (A. th genome BLAST matches underlined)
>39-K032007-022-181-D04C-8409
CGGAAGGGGACAGTAAGAAGGATACTCATTTATGTCTTTTCTGTGAATTTGTGTTTTTGC
CATTTTTCATGTTATATTCTCTAAACATTTTGACTCTCATTTCAGAAAGAAGAAGGCTGT
TCACAAGACCACTACAACCGATGACAAGAGGCTCCAGAGCACTCTTAAGAGAGTTGGAGT
CAATTCCATTCCCGCCATTGAAGAAGTTAACATTTTTAAGGATGATGTAGTCATTCAGTT
CATTAACCCTAAAGGTAAAACATCAAATTTTATGGCTTTATAAATCTCAGGTTTCGTATA
AAATTTATTGTATTAATGGTTGTTGTGTCTCTGTTTTAATGTTGCTATCACAGTTCAAGC
TTCAATTGCTGCTAACACATGGGTTGTGAGTGGTACACCACAGACGAAAAGTAAGTGTTT
GTATCCTCATTGTTGATCCAATACTATTCTCGGTTTATGCATAGTCTAATCTCGGAATGT
GATTTATCCT
GenBank Accession HG968803 [GenBank]
Graphic View Graphic view of gene At1g73230
Predicted Position of Insertion Chr1:27541313 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T18K17
Hit Gene Code At1g73230 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Nascent polypeptide-associated complex NAC
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03