SimpleSearch - Line and FST details


Line specific information

 
Line ID 182B12
Vector Used pAC161
Line Availability only available from NASC (N417400)
Segregation Analysis 100:78:60
Confirmed for Hit At3g02150
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g02150

Sequence (A. th genome BLAST matches underlined)
>90-K013594-022-182-B12-8409
TGATCCATGTAGATTTACCGCGCCTTTGGAGGCAAAGACCGTCACAGCAAAGTGTGTACG
TTACGTGGACTACGTGACAGACGCGTGAGATTATCAGTCCCAACGGCTATTCAGCTCTAC
GATCTTCAAGAACGGCTCGGTGTTGACCAGCCTATGGGATCCTCCCTATAGTGAG
GenBank Accession AL771667 [GenBank]
Graphic View Graphic view of gene At3g02150
Predicted Position of Insertion Chr3:391729 - go to primer design
BLAST e Value 6e-71
Hit Clone Code (BAC ID) F1C9
Hit Gene Code At3g02150 [TAIR] [MIPS] [SIGnAL]
Gene Annotation plastid transcription factor 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Related paper(s) [Koyama et al. 2010, tcp13-2]

Gene hit MMB12

 
Sequence (A. th genome BLAST matches underlined)
>88-K020161-022-182-B12t-8409
ATTGAAATATCCTGATCAATATGAAGTCTAAAATCACTACCTCCTATGGGATCCTCCCTA
TAGTGAG
GenBank Accession BX530810 [GenBank]
Graphic View Graphic view of sequence BX530810 of line 182B12
Predicted Position of Insertion Chr3:6802105 - go to primer design
BLAST e Value 4e-11
Hit Clone Code (BAC ID) MMB12
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 14.10.2014 10:23