SimpleSearch - Line and FST details


Line specific information

 
Line ID 182D08
Vector Used pAC161
Line Availability only available from NASC (N417420)
Segregation Analysis 100:93:84
Confirmed for Hit At2g26330
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g26330

 
Sequence (A. th genome BLAST matches underlined)
>60-K013594-022-182-D08-8409
CTGATCCATGGTAGATTTCCCGGACATGAANGCCTTTACAATTGAATGTATCCTGTAAAT
TTGCCTTGGGGATTAGGAGCATCTTGTAAGATGTGAGCATCCATGAGAACTCCGCTCATA
TTGTTGATGTCCTATGGGAAGCTAACTATAGAGACTTACAATGTATCTAAGTTACCGATA
CGAGATAGCTCAACCGGGATTGGACCTTTGATATTGTTGCTGGACAGATTACTGGTTGAA
CCGATAAATCAAAGGCAACCAAAAACTCAGTAGTTAATGACTTGAAATTCGAAAAAACAA
ACGCTGTGGAACTATATATTATATAAGATTAGAGAAATTCTCAGCGTCGATACTTACAGG
TAAGTCATACTTCCTATGGGATCCTCC
GenBank Accession AL771695 [GenBank]
Graphic View Graphic view of gene At2g26330
Predicted Position of Insertion Chr2:11210819 - go to primer design
BLAST e Value 2e-120
Hit Clone Code (BAC ID) T1D16
Hit Gene Code At2g26330 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Leucine-rich receptor-like protein kinase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL771696 [GenBank]


Last Updated on 14.10.2014 10:23