SimpleSearch - Line and FST details


Line specific information

 
Line ID 183E10
Vector Used pAC161
Line Availability only available from NASC (N417530)
Segregation Analysis 50:46:36
Confirmed for Hit At5g02450
Parent of DUPLO pair none
Parent of pair(s) 6947, 9029

Gene hit At5g02450

 
Sequence (A. th genome BLAST matches underlined)
>77-K013614-022-183-E10-8409
NTGATCCATGGTAGATTTCCCGGACATGAANGCCTTTACAATTGAATATATCCTGACACA
CCACCGAGTAGTTAAACTAAAAGTGACCAATGGAATCAAATAGGACTAAGTAGAAGAAAC
AGAGTAAGTAACATTAGAGAGCTTACCCCTTTTCTGTTGTTAGGGCGAGGAGGTTGCTCG
CGTTTGGTAACAACGTGTCCTTTGTTTAGCCCCACGAATAAGCCTGTCGCCACCATTTTC
TCTGCCAATTTCAATAATCGTGACATATTTAGTTCAAGAACAAAATCTCAGATCTACTCT
TCTATGCGATTTTCTCTTCAGATAAGCTATATCTATCTTCTAATATTATCAGCTCAATTC
CAAAACTGATTTTACGGACGAACAATTCAATTTCTCAAAAACGATTGAATAAGCAAATCG
CGATGTACTCTATGGGATCCTC
GenBank Accession AL771828 [GenBank]
Graphic View Graphic view of gene At5g02450
Predicted Position of Insertion Chr5:533677 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T1E22
Hit Gene Code At5g02450 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ribosomal protein L36e family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL771827 [GenBank]


Last Updated on 14.10.2014 10:23