SimpleSearch - Line and FST details


Line specific information

 
Line ID 183F08
Vector Used pAC161
Line Availability only available from NASC (N417540)
Segregation Analysis 50:38:36
Confirmed for Hit At3g20550
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g20550

 
Sequence (A. th genome BLAST matches underlined)
>62-K013595-022-183-F08-8409
TTGATCCATGGTAGATTTCCCGTCACATGAAGCCTTTACAATTGAATATATCCTGACCCT
ATGGGATCCTCCCTATAGTGAGAGGGAAAGATACAAATTGAAACCAGGGTCAGAAGGAAA
AGGCATGTGAGCTCCATATAGCACAGGAAACCCTAATTCCCAAATGCATACAAACTACAA
ATGGAGCATAAGCCCTATAGCGAAGAACGGAAGACTACAGATTGCAGATGCTAAGTTGAG
AGGACCCGGGCATAGCCTATGGGATCGTCCCTATAGAGAGCCTGCATCACATATGGAGTT
TCTTGACCTTATCGAATCTGACCATTGCCCGATCATAACGACAATCACTATGGGATCCTC
CCTATAGC
GenBank Accession CR770272 [GenBank]
Graphic View Graphic view of gene At3g20550
Predicted Position of Insertion Chr3:7177639 - go to primer design
BLAST e Value 9e-39
Hit Clone Code (BAC ID) K10D20
Hit Gene Code At3g20550 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation SMAD/FHA domain-containing protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR770272 [GenBank]


Last Updated on 31.08.2016 09:40