SimpleSearch - Line and FST details


Line specific information

 
Line ID 184C10
Vector Used pAC161
Line Availability only available from NASC (N417602)
Segregation Analysis 50:33:24
Confirmed for Hit At2g22990
Parent of DUPLO pair none
Parent of pair(s) 10508, 10526, 80173, 80190, 80204, 80205, 80206, 80207, 80208, 80209, 80210, 80211, 80212, 80213, 80214, 80215, 80216, 80217

Gene hit At2g22990

 
Sequence (A. th genome BLAST matches underlined)
>75-K013651-022-184-C10-8409
TGATCCATGTANGATTTCCCGGACATGAAGCACTTTACAATTGAATATATCCATCATACT
CTTTCTTTTTCTACTTTTATATCCATTGAAGCCATGTAGTAAAATATATTTTCTTACCAA
ACAAAAACAGGGTTATATGCTTGGAAACCCTGTAACATATATGGACTTTGAACAAAACTT
CCGCATTCCATATGCTTATGGTATGGGATTAATCTCCGACGAAATCTATGAGGTATGAAA
TAAGGCATGCTTATATTGTCACTATGGGATCCTCCCTATAGTGAG
GenBank Accession AL771912 [GenBank]
Graphic View Graphic view of gene At2g22990
Predicted Position of Insertion Chr2:9787704 - go to primer design
BLAST e Value 7e-86
Hit Clone Code (BAC ID) T20K9
Hit Gene Code At2g22990 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation sinapoylglucose 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL771911 [GenBank]


Last Updated on 31.08.2016 09:40