SimpleSearch - Line and FST details


Line specific information

 
Line ID 184F04
Vector Used pAC161
Line Availability only available from NASC (N417632)
Segregation Analysis 100:97:74
Confirmed for Hit At2g35240
Parent of DUPLO pair none
Parent of pair(s) 88740, 88741

Gene hit At2g35240

 
Sequence (A. th genome BLAST matches underlined)
>30-K013651-022-184-F04-8409
NTGATCCATTGTAGATTTCCCGGACATGAAGCACTTTACAAGCTAAAATTGTTGGCAGGT
GAGTGTCTTTGTCTTGTTCGTTAGTGTTGTTCCTCAGCTACTTCTCTTAACAAACTGAAT
CTGATTGTTGTTTGGTTTAATAGGTGAGGAAGAGGCTAGGGGATCCTCCCTATTTAATTG
GCCCATTTGAGCCGTCTCACTTATCCTTCCGGTTCCGGATCGTCCTCAATCTTGTCAAAG
CTGGTATGTATCCCACGGCGTGGAACATCGTCCGCGAGAATCGACGAGAGATGAGATGAG
AAGGAAGCGGAGAAGGACAGGCTACTGCATTGTAGGTGGAAAATAAACGCTTAGCGACTC
ATGAGGCGGTGGATCGCGATAGACCTTTCGCCATTGAGACTGCTGTGGCTTCCCGGCGAT
GenBank Accession AL771934 [GenBank]
Graphic View Graphic view of gene At2g35240
Predicted Position of Insertion Chr2:14845927 - go to primer design
BLAST e Value 3e-63
Hit Clone Code (BAC ID) T4C15
Hit Gene Code At2g35240 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation plastid developmental protein DAG
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL771933 [GenBank]


Last Updated on 07.07.2016 14:03