SimpleSearch - Line and FST details


Line specific information

 
Line ID 184F05
Vector Used pAC161
Line Availability only available from NASC (N417633)
Segregation Analysis 50:27:24
Confirmed for Hit At3g22110
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g22110

 
Sequence (A. th genome BLAST matches underlined)
>38-K013649-022-184-F05-8409
NTGATCCATGGTAGATTTCCCGGACATGAACGCCTTTACAATTGAATATAGTCCTGCGGA
TATATGTGTTTTATCGTTCTTTTGGGCTTAATATGGTTCAGACACGCGGGTTGAGTCACA
CCGTGCTAGACCAACAGTTTGGTGAGCGACTCAGGTGAGTGAACATGGTACTTAACAGTC
TTGGATGGAGTCAGATACACTTCAGCAAGCTCTATGGGATCCTCCC
GenBank Accession AL771935 [GenBank]
Graphic View Graphic view of gene At3g22110
Predicted Position of Insertion Chr3:7792790 - go to primer design
BLAST e Value 3e-54
Hit Clone Code (BAC ID) MKA23
Hit Gene Code At3g22110 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation 20S proteasome alpha subunit C1
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL771936 [GenBank]


Last Updated on 31.08.2016 09:40