SimpleSearch - Line and FST details


Line specific information

 
Line ID 185B11
Vector Used pAC161
Line Availability only available from NASC (N417687)
Segregation Analysis 50:44:41
Confirmed for Hit At2g34810
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g34810

 
Sequence (A. th genome BLAST matches underlined)
>82-K013652-022-185-B11-8409
CTGATCCATGTAGATTTCCCGGACATGAAGTCATTTACAATTGAATATATTATCGCGTCT
ATGCAACTGCTCCTCGAAATCTTACGCTATCGCATCCATTTCTAACGTCTATCTGGATTT
CTCATTTGATATACAAACTCGTCTTGTAAGTGGCTAATGATCCTCATTGTTTGAAAAATC
TTTGCAAGACCCTGTTTTGAGATTGGTGCTTGAACAAAATCTGAAGTACGTTTCCAGTAG
TATTCGTTGGTTGATACTCTTTTGAGAAGTAACTCTATCGGTGCTTTTTCTGGATAATTC
GCCCAGAAAACACTATGGGATCCTCCCTATAGTGAG
GenBank Accession AL771980 [GenBank]
Graphic View Graphic view of gene At2g34810
Predicted Position of Insertion Chr2:14686595 - go to primer design
BLAST e Value 1e-84
Hit Clone Code (BAC ID) F19I3
Hit Gene Code At2g34810 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation FAD-binding Berberine family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit T6A9

 
Sequence (A. th genome BLAST matches underlined)
>82-K013650-022-185-B11-8409
NTGATCCATGTAGATTACCCGGACATGAAGCACTTTTTGAGCGGCTCATCGGACCGCGAT
AGGCCGACGCGAATCGGTGGTTGCGTAGGGAGCGCAACGACCGAAGGGTATGCGCTTTTT
GCAGCAATATTCAATTGAATATTACCATGGCTATGGGATCCTCCCTATAGGGAGATATAT
ACCATGTTGGTCCATGCATGTAAAGTGCAAAGAGTTTAAGAGTTGTTGTAAAAAGCATAA
AAAATTTGAACCCTTTTTTTTTTTTTATGCGGAAACTTTGGGAATCCTCCATAAAGGGAG
GNNANNTCNCTCTGCGGCCTCTCCTTTGTGTGAGTGCTGGCCTTNGTGGTAGCCAACTTT
CTTTTTAACTATCTAAATAATACAGGGACAGAGGGCTGGGCGGTGCGATCCCGAGAGGCC
CCTGTATATCAACCTGTGGAAAACAGTGTCGAATGGCCCTGGAATGTCCGGGACGCCCTC
CCCNTCGAAAAAATGGGTTTACAAGGAGGGGGACGGAAAAAACGCATGGCCCCGCCTCGC
CCACGCGGTATATTCCCCCCCCCCCACATCTCCCCTCGTCGCCCGCGCAATAAAAGAGGT
TTAAGT
GenBank Accession AL771979 [GenBank]
Graphic View Graphic view of sequence AL771979 of line 185B11
Predicted Position of Insertion Chr1:502215 - go to primer design
BLAST e Value 3e-32
Hit Clone Code (BAC ID) T6A9
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 07.07.2016 14:03