SimpleSearch - Line and FST details


Line specific information

 
Line ID 185D07
Vector Used pAC161
Line Availability only available from NASC (N417707)
Segregation Analysis 100:88:61
Confirmed for Hit At3g21270
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g23325

 
Sequence (A. th genome BLAST matches underlined)
>52-K013652-022-185-D07-8409
AGTATTTCGGAAGTTCACGTTTTTTTTATCCAAATTTAAAAGTTAATGATTTGGTTTGAT
TGAAATGTCCGGTTCTGGACGGGTTTTCTTTTGTACCGGTTCTCATAATAATAGCCACGT
ATTAAAAGTTTATTAGGTAATGGATTTGGGCCAGACCCATTCTCAAAGCCCAATCAATTT
CTCAGTGAACCATATATAAACCTAATTAACGTGAAGCAGAAGTCGTATCCTTCTTCTTGC
GAACTCGCTGAAGCTCTGAAAGATGCAGGTTTGTCTCTCTCGATTCGAAACCCTATGGGA
TCCTCCCTA
GenBank Accession AL772010 [GenBank]
Graphic View Graphic view of gene At3g23325
Predicted Position of Insertion Chr3:8345560 - go to primer design
BLAST e Value 6e-120
Hit Clone Code (BAC ID) MLM24
Hit Gene Code At3g23325 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Splicing factor 3B subunit 5/RDS3 complex subunit 10
Insertion Classification Promoter
Confirmation Status unknown

Gene hit At3g21270

 
Sequence (A. th genome BLAST matches underlined)
>52-K013650-022-185-D07-8409
CTGATCCATGGTAGATTTCCCGGACATGAAGTCACTTTCTGTTGATTACTTAGAACCAAA
CCTGTTTTATATTGTGGATGGTTGACTTGAGGGTGATTCTTGATTTGGTTCAGTGTGTTT
GAGGAGACAATGATACCGAACTTTTTTTATCTGCGTACTTTTCTGCACCACATGGAAAAC
ACGCATTGGTACTTGGGTGATGATAAGGATATCATGGTTACACCAGGGCCTAGCCCGAGG
TCAATGTGCAAAGCAACCAACGAGTACCCATGGGAACAAAATAACGCTATTCCGACCCGC
TATGGGATTCTACCTATAGAGAGACGAGCTAAAGCTTCCACCAATCTCCATACCCTTCAC
GTGTTGGTCACCGATCGGAAACCCGTATAGCATCCGGGTCGGATCCAAATCCGGTTTTTG
AGAATTACGTGGATCAGGATCCGGATCCGGGTTTTTCGTCTTCTTGTTTTGGCTACTGGT
GGAAGGAGAGGAACCACAAGAAGAAGAAGAAGTGGATCGTTTGGTTGCGTTCTTACCACA
CCACCACCGACGG
GenBank Accession BX546578 [GenBank]
Graphic View Graphic view of gene At3g21270
Predicted Position of Insertion Chr3:7475646 - go to primer design
BLAST e Value 3e-106
Hit Clone Code (BAC ID) MXL8
Hit Gene Code At3g21270 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation DOF zinc finger protein 2
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40