Line specific information

Line ID 185E10
Vector Used pAC161
Line Availability available from GABI-Kat
Segregation Analysis 50:46:36
Although the line exists, the insertion in At1g66730 can not be ordered because the confirmation of this insertion failed.

Gene hit At1g66730

Sequence (A. th genome BLAST matches underlined)
>77-K013650-022-185-E10-8409
TAACATCTGCTCTTTAGTGACCCAAGCAGGCAAAGAATCACGTAGTTTTATCAGCAATCT
TGAATCACTACTTGGAGTTGTATCATGCAATATGGGTCCTCTATGGGATCCTC
GenBank Accession AL772034 [GenBank]
Graphic View Graphic view of gene At1g66730
T-DNA Border 181 base(s) before start of sequence
BLAST e Value 8e-50
Hit Clone Code (BAC ID) F4N21
Hit Gene Code At1g66730 [TAIR] [MIPS] [SIGnAL]
Gene Annotation ATP dependent DNA ligase family protein
Insertion Classification CDSi
Confirmation Status failed, line belongs to a contamination group, please check line 185E11
Other FSTs Supporting this Hit AL772035