Line specific information

Line ID 185E11
Vector Used pAC161
Line Availability only available from NASC (N417723)
Segregation Analysis 50:50:34
Confirmed for Hit At1g66730

Gene hit At1g66730

Sequence (A. th genome BLAST matches underlined)
>85-K013650-022-185-E11-8409
CAAGCAGGCAAAGAATCACGTAGTTTTATCAGCAATCTTGAATCACTACTTGGAGTTGTA
TCATGCANTATGGGTCCTCTA
GenBank Accession AL772036 [GenBank]
Graphic View Graphic view of gene At1g66730
T-DNA Border 328 base(s) before start of sequence
BLAST e Value 2e-37
Hit Clone Code (BAC ID) F4N21
Hit Gene Code At1g66730 [TAIR] [MIPS] [SIGnAL]
Gene Annotation ATP dependent DNA ligase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Other FSTs Supporting this Hit AL772037