SimpleSearch - Line and FST details


Line specific information

 
Line ID 185F12
Vector Used pAC161
Line Availability only available from NASC (N417736)
Segregation Analysis 50:50:43
Confirmed for Hit At1g20925
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g20925

 
Sequence (A. th genome BLAST matches underlined)
>94-K013652-022-185-F12-8409
NATTGATCCATGATAGACTTTCCCTGACATGAANGCCTTTACACTTGAATATATCCTGTT
AGCACACTTTCTGATTTTGAGAGAATGTATATGTGACAAGGTTGGGACTTGGGGCAACGG
TCAAACAAAGAGTGTGCTCTGTAGCAGAGAAAATCAATCTACGAACAATATTTGCTCCTT
CAACTATTGCACCGGTTTGTTCCATGCACATTTCACCTATGGTATCCTCCCTACCGCGAT
GACCATGGAACAAATCCGCTCCCCCCGTATCTCCCCTCCTCGTTACTTGTTGTTTTCCTT
CCCCTGCCTCCATATGTTATTCCCCCCCCCCCCTCCCCCCTTTTTTTTCCCCCCCCCCCT
CCTACCCTTTTTTCCCCCCCCCCCCCCACTCGCCCACCCCATTATTCCTTCACCCCCCCG
TTTTTCCCCTCTTCTCCTCCTTCCCCCGCGCTCTCTCCCCCCCCCCATTTATTATACCTT
CCTTCTCCCCACCCCCCTCTCTTCTCTCCCCCCACTTCTTTTCCCTTTTTTTTTATCCTT
TCTCGCCCCACCCCCACTTATCGCCCCCCTGTCCAACCCCCCCCCCACCCTCGACCCCCC
TTTACGCCGCCCCTCCCCCCCCTTTTCTTTCCCTCCCCCTTCTTTTACCCCTCCCCTCCT
GCCCACACCCTCGTGTCCATCTATTCCGCCGCTCTCCCCCCGATCCCCCTATATCTTCTC
CATTTACATCCCCCCCGTCTCTCTTCTTTTCCCCCCGCCCTCCTTTTTCGCCCCCCCCCA
TCCTTTTTTTTCTTGCGTTCCCCCCCCCCCCCGTCCTCTTTCTCTTCTTAATCCACCTTT
GTTCCTTCCCCCACTCCACTATCTTCACCCTTTTCCCGCCCGCGTTTNTTTGCGCGCCGC
CCACCCTCCCCCTTCCCCCGCTCACCTCTTCCTCTGTATTCCCCACCTCACCCCCGTTTG
ATTTATCTCACCTCCGAGCCACTTCGATATTCTCTTGTCCACCACACCGTTCCTCCCC
GenBank Accession AL772053 [GenBank]
Graphic View Graphic view of gene At1g20925
Predicted Position of Insertion Chr1:7291566 - go to primer design
BLAST e Value 6e-62
Hit Clone Code (BAC ID) F9H16
Hit Gene Code At1g20925 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Auxin efflux carrier family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03