SimpleSearch - Line and FST details


Line specific information

 
Line ID 186D02
Vector Used pAC161
Line Availability only available from NASC (N417798)
Segregation Analysis 100:57:39
Confirmed for Hit At5g52470
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g52470

 
Sequence (A. th genome BLAST matches underlined)
>12-K014618-022-186-D02-8409
NTGATCCATGGTAGATTTCCCGGACATGAANGCCTTTACAATTGAATATATCATGTAGAT
AACAAAGTGTCCACCAGTTTTGAGGAAAAATGAGGCATTCAGGGCCAAGATTCTTGCCTT
CAAGAGTTAGGCAAATAGATGGATTCAATTAAATAAAACATAAACAGAGAACCAAAATGA
GAATAAAGAGAGACATTAACATAAACATAGAAACATTTATGGAATCATTGCAGATTTCTT
GGAGCAATCTCTGCTATGGGATCCTCCCATAGGTGAG
GenBank Accession BX890867 [GenBank]
Graphic View Graphic view of gene At5g52470
Predicted Position of Insertion Chr5:21296223 - go to primer design
BLAST e Value 3e-109
Hit Clone Code (BAC ID) K24M7
Hit Gene Code At5g52470 [TAIR] [MIPS] [SIGnAL]
Gene Annotation fibrillarin 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23