SimpleSearch - Line and FST details


Line specific information

 
Line ID 186D09
Vector Used pAC161
Line Availability only available from NASC (N417805)
Segregation Analysis 50:13:11
Confirmed for Hit At3g18880
Parent of DUPLO pair none
Parent of pair(s) 378

Gene hit At3g18880

 
Sequence (A. th genome BLAST matches underlined)
>68-K014618-022-186-D09-8409
TGATCCATGGTAGATTTCCCGGACATGAANGCCTTTACAATTGAATATATCATATGAAAA
TTGAATTGCATTTTCCTTGAAAATCACTTTTCCTTGAAATGCAATTCAACTCTTAGGACT
CCTGTAACATCGGCGATCGAGTATTTTCCCCTTCATTTTTTGAATTTGATATACATTTGA
TCAAGAGCTCGAAAATTTAGGGAAGCTCTATGGGATCCTCCCATAAGTGA
GenBank Accession AL772124 [GenBank]
Graphic View Graphic view of gene At3g18880
Predicted Position of Insertion Chr3:6509668 - go to primer design
BLAST e Value 4e-47
Hit Clone Code (BAC ID) MCB22
Hit Gene Code At3g18880 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Nucleic acid-binding, OB-fold-like protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40