SimpleSearch - Line and FST details


Line specific information

 
Line ID 186F12
Vector Used pAC161
Line Availability only available from NASC (N417832)
Segregation Analysis 50:20:18
Confirmed for Hit At4g15500
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g15500

 
Sequence (A. th genome BLAST matches underlined)
>94-K014618-022-186-F12-8409
TGTATTTTTTTATGTACATATTAATTTCTGTTGTTGTTGTGTGTGTTTTTTTGGTTCTTG
AGGGAGAATATTTGATTGATGCAAGGGTTCAAAATTGCTATGGGATCCTCCCTATACTGA
GATAAATCGAGGTATCTAAATTGGAAATATTGTAAAGAAGACAAAAACTTCTTTTTGAGT
TTTACCAACAAAAAAAAAATTTGGGAAAGGGAATCGCCGTTCCCTAAGGGGAGGCTGGTA
TCATCCCCGGGGCAGGGCCACATAACCCTTTTTTTTCGTTTGGAAAAAACCTTGGCCTTA
AAAGGCTA
GenBank Accession AL759389 [GenBank]
Graphic View Graphic view of gene At4g15500
Predicted Position of Insertion Chr4:8858672 - go to primer design
BLAST e Value 2e-30
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g15500 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation UDP-Glycosyltransferase superfamily protein
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03